ID: 1148755787

View in Genome Browser
Species Human (GRCh38)
Location 17:49972314-49972336
Sequence CGGGTCACCTTCCCTGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755781_1148755787 5 Left 1148755781 17:49972286-49972308 CCGGGCTACGCTGCGCGCTCTTG 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1148755787 17:49972314-49972336 CGGGTCACCTTCCCTGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1148755778_1148755787 10 Left 1148755778 17:49972281-49972303 CCCCGCCGGGCTACGCTGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148755787 17:49972314-49972336 CGGGTCACCTTCCCTGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1148755779_1148755787 9 Left 1148755779 17:49972282-49972304 CCCGCCGGGCTACGCTGCGCGCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1148755787 17:49972314-49972336 CGGGTCACCTTCCCTGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1148755780_1148755787 8 Left 1148755780 17:49972283-49972305 CCGCCGGGCTACGCTGCGCGCTC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1148755787 17:49972314-49972336 CGGGTCACCTTCCCTGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1148755777_1148755787 20 Left 1148755777 17:49972271-49972293 CCAGGAGTGGCCCCGCCGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1148755787 17:49972314-49972336 CGGGTCACCTTCCCTGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755787 Original CRISPR CGGGTCACCTTCCCTGCCGC CGG Intronic