ID: 1148757776

View in Genome Browser
Species Human (GRCh38)
Location 17:49983285-49983307
Sequence TAGGCACATGATGGTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148757767_1148757776 5 Left 1148757767 17:49983257-49983279 CCCCTGTCATCATCCCTTCTGCT No data
Right 1148757776 17:49983285-49983307 TAGGCACATGATGGTTTCCTGGG No data
1148757768_1148757776 4 Left 1148757768 17:49983258-49983280 CCCTGTCATCATCCCTTCTGCTG No data
Right 1148757776 17:49983285-49983307 TAGGCACATGATGGTTTCCTGGG No data
1148757772_1148757776 -8 Left 1148757772 17:49983270-49983292 CCCTTCTGCTGGTTCTAGGCACA No data
Right 1148757776 17:49983285-49983307 TAGGCACATGATGGTTTCCTGGG No data
1148757769_1148757776 3 Left 1148757769 17:49983259-49983281 CCTGTCATCATCCCTTCTGCTGG No data
Right 1148757776 17:49983285-49983307 TAGGCACATGATGGTTTCCTGGG No data
1148757773_1148757776 -9 Left 1148757773 17:49983271-49983293 CCTTCTGCTGGTTCTAGGCACAT No data
Right 1148757776 17:49983285-49983307 TAGGCACATGATGGTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148757776 Original CRISPR TAGGCACATGATGGTTTCCT GGG Intergenic
No off target data available for this crispr