ID: 1148758529

View in Genome Browser
Species Human (GRCh38)
Location 17:49987317-49987339
Sequence GAAAGCTTAATGTTGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148758529_1148758540 16 Left 1148758529 17:49987317-49987339 CCTGACTGCAACATTAAGCTTTC No data
Right 1148758540 17:49987356-49987378 CCTCTCCATTTCGCCTCCCAGGG No data
1148758529_1148758543 28 Left 1148758529 17:49987317-49987339 CCTGACTGCAACATTAAGCTTTC No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758529_1148758538 15 Left 1148758529 17:49987317-49987339 CCTGACTGCAACATTAAGCTTTC No data
Right 1148758538 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
1148758529_1148758542 27 Left 1148758529 17:49987317-49987339 CCTGACTGCAACATTAAGCTTTC No data
Right 1148758542 17:49987367-49987389 CGCCTCCCAGGGAAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148758529 Original CRISPR GAAAGCTTAATGTTGCAGTC AGG (reversed) Intergenic
No off target data available for this crispr