ID: 1148758531

View in Genome Browser
Species Human (GRCh38)
Location 17:49987339-49987361
Sequence GAGAGGGGAGGGCTGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148758531_1148758553 25 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758553 17:49987387-49987409 AGGGAGGAGGGCTGGCCAGCTGG No data
1148758531_1148758540 -6 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758540 17:49987356-49987378 CCTCTCCATTTCGCCTCCCAGGG No data
1148758531_1148758545 9 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758545 17:49987371-49987393 TCCCAGGGAAGAACCCAGGGAGG No data
1148758531_1148758556 30 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758556 17:49987392-49987414 GGAGGGCTGGCCAGCTGGGGTGG No data
1148758531_1148758548 12 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758548 17:49987374-49987396 CAGGGAAGAACCCAGGGAGGAGG No data
1148758531_1148758554 26 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758554 17:49987388-49987410 GGGAGGAGGGCTGGCCAGCTGGG No data
1148758531_1148758550 17 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758550 17:49987379-49987401 AAGAACCCAGGGAGGAGGGCTGG No data
1148758531_1148758555 27 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758555 17:49987389-49987411 GGAGGAGGGCTGGCCAGCTGGGG No data
1148758531_1148758543 6 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758531_1148758538 -7 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758538 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
1148758531_1148758549 13 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758549 17:49987375-49987397 AGGGAAGAACCCAGGGAGGAGGG No data
1148758531_1148758542 5 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758542 17:49987367-49987389 CGCCTCCCAGGGAAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148758531 Original CRISPR GAGAGGGGAGGGCTGGTCCT GGG (reversed) Intergenic
No off target data available for this crispr