ID: 1148758533

View in Genome Browser
Species Human (GRCh38)
Location 17:49987346-49987368
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148758533_1148758550 10 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758550 17:49987379-49987401 AAGAACCCAGGGAGGAGGGCTGG No data
1148758533_1148758545 2 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758545 17:49987371-49987393 TCCCAGGGAAGAACCCAGGGAGG No data
1148758533_1148758555 20 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758555 17:49987389-49987411 GGAGGAGGGCTGGCCAGCTGGGG No data
1148758533_1148758558 27 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758558 17:49987396-49987418 GGCTGGCCAGCTGGGGTGGGTGG No data
1148758533_1148758556 23 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758556 17:49987392-49987414 GGAGGGCTGGCCAGCTGGGGTGG No data
1148758533_1148758553 18 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758553 17:49987387-49987409 AGGGAGGAGGGCTGGCCAGCTGG No data
1148758533_1148758557 24 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758557 17:49987393-49987415 GAGGGCTGGCCAGCTGGGGTGGG No data
1148758533_1148758548 5 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758548 17:49987374-49987396 CAGGGAAGAACCCAGGGAGGAGG No data
1148758533_1148758543 -1 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758533_1148758559 28 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758559 17:49987397-49987419 GCTGGCCAGCTGGGGTGGGTGGG No data
1148758533_1148758554 19 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758554 17:49987388-49987410 GGGAGGAGGGCTGGCCAGCTGGG No data
1148758533_1148758549 6 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758549 17:49987375-49987397 AGGGAAGAACCCAGGGAGGAGGG No data
1148758533_1148758560 29 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758560 17:49987398-49987420 CTGGCCAGCTGGGGTGGGTGGGG No data
1148758533_1148758542 -2 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758542 17:49987367-49987389 CGCCTCCCAGGGAAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148758533 Original CRISPR CGAAATGGAGAGGGGAGGGC TGG (reversed) Intergenic
No off target data available for this crispr