ID: 1148758537

View in Genome Browser
Species Human (GRCh38)
Location 17:49987355-49987377
Sequence CCTGGGAGGCGAAATGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148758537_1148758555 11 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758555 17:49987389-49987411 GGAGGAGGGCTGGCCAGCTGGGG No data
1148758537_1148758543 -10 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758537_1148758554 10 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758554 17:49987388-49987410 GGGAGGAGGGCTGGCCAGCTGGG No data
1148758537_1148758560 20 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758560 17:49987398-49987420 CTGGCCAGCTGGGGTGGGTGGGG No data
1148758537_1148758548 -4 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758548 17:49987374-49987396 CAGGGAAGAACCCAGGGAGGAGG No data
1148758537_1148758563 29 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758563 17:49987407-49987429 TGGGGTGGGTGGGGCTGTGGTGG No data
1148758537_1148758562 26 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758562 17:49987404-49987426 AGCTGGGGTGGGTGGGGCTGTGG No data
1148758537_1148758549 -3 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758549 17:49987375-49987397 AGGGAAGAACCCAGGGAGGAGGG No data
1148758537_1148758559 19 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758559 17:49987397-49987419 GCTGGCCAGCTGGGGTGGGTGGG No data
1148758537_1148758557 15 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758557 17:49987393-49987415 GAGGGCTGGCCAGCTGGGGTGGG No data
1148758537_1148758550 1 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758550 17:49987379-49987401 AAGAACCCAGGGAGGAGGGCTGG No data
1148758537_1148758558 18 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758558 17:49987396-49987418 GGCTGGCCAGCTGGGGTGGGTGG No data
1148758537_1148758553 9 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758553 17:49987387-49987409 AGGGAGGAGGGCTGGCCAGCTGG No data
1148758537_1148758545 -7 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758545 17:49987371-49987393 TCCCAGGGAAGAACCCAGGGAGG No data
1148758537_1148758556 14 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758556 17:49987392-49987414 GGAGGGCTGGCCAGCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148758537 Original CRISPR CCTGGGAGGCGAAATGGAGA GGG (reversed) Intergenic
No off target data available for this crispr