ID: 1148758543

View in Genome Browser
Species Human (GRCh38)
Location 17:49987368-49987390
Sequence GCCTCCCAGGGAAGAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148758535_1148758543 -6 Left 1148758535 17:49987351-49987373 CCTCCCCTCTCCATTTCGCCTCC No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758529_1148758543 28 Left 1148758529 17:49987317-49987339 CCTGACTGCAACATTAAGCTTTC No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758534_1148758543 -5 Left 1148758534 17:49987350-49987372 CCCTCCCCTCTCCATTTCGCCTC No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758536_1148758543 -9 Left 1148758536 17:49987354-49987376 CCCCTCTCCATTTCGCCTCCCAG No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758531_1148758543 6 Left 1148758531 17:49987339-49987361 CCCAGGACCAGCCCTCCCCTCTC No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758537_1148758543 -10 Left 1148758537 17:49987355-49987377 CCCTCTCCATTTCGCCTCCCAGG No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758532_1148758543 5 Left 1148758532 17:49987340-49987362 CCAGGACCAGCCCTCCCCTCTCC No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data
1148758533_1148758543 -1 Left 1148758533 17:49987346-49987368 CCAGCCCTCCCCTCTCCATTTCG No data
Right 1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148758543 Original CRISPR GCCTCCCAGGGAAGAACCCA GGG Intergenic
No off target data available for this crispr