ID: 1148759755

View in Genome Browser
Species Human (GRCh38)
Location 17:49993630-49993652
Sequence GTCGCAGGAGTCGCAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148759755_1148759760 -5 Left 1148759755 17:49993630-49993652 CCTCGGCCTGCGACTCCTGCGAC 0: 1
1: 0
2: 0
3: 3
4: 109
Right 1148759760 17:49993648-49993670 GCGACCCTCCAGGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 163
1148759755_1148759772 30 Left 1148759755 17:49993630-49993652 CCTCGGCCTGCGACTCCTGCGAC 0: 1
1: 0
2: 0
3: 3
4: 109
Right 1148759772 17:49993683-49993705 TCCGCCCACCGACTCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 49
1148759755_1148759771 29 Left 1148759755 17:49993630-49993652 CCTCGGCCTGCGACTCCTGCGAC 0: 1
1: 0
2: 0
3: 3
4: 109
Right 1148759771 17:49993682-49993704 TTCCGCCCACCGACTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148759755 Original CRISPR GTCGCAGGAGTCGCAGGCCG AGG (reversed) Intronic
901614822 1:10530421-10530443 GCCGGCGGAGGCGCAGGCCGGGG - Intronic
901628981 1:10639046-10639068 CTCGGAGGAGTCGCTGCCCGAGG - Exonic
903829105 1:26164349-26164371 GTGGCAGCAGCAGCAGGCCGCGG - Intergenic
905031372 1:34886210-34886232 GGAGCTGGAGTCCCAGGCCGTGG - Exonic
905107612 1:35573761-35573783 GGCGCAGGAGCCTCAGGCTGGGG - Intronic
905219029 1:36431224-36431246 GACTCAGGAGTCACAGGCAGAGG + Intronic
905632136 1:39524781-39524803 GTCGCGGGAGTGGAAGGCAGAGG + Intronic
907524936 1:55048521-55048543 GTGGCAGGAATGGCAGGCAGGGG + Intronic
912477372 1:109947803-109947825 GCTGCAGGAGTGGCAGGCCTTGG - Intergenic
916676317 1:167066772-167066794 GTAGCGGGAGTCGCAGGCTTCGG - Intronic
922555438 1:226528739-226528761 GTGGCAGGGGTCGCAGGGTGTGG - Intergenic
923191865 1:231627283-231627305 GGCGCAGGTGTCCCAGGACGGGG - Intronic
1067227621 10:44386020-44386042 GTCCTAGGAGTCGGAGGTCGGGG - Intronic
1074819429 10:117167593-117167615 CTCCCAGGAATCGCGGGCCGTGG + Intergenic
1077050012 11:562369-562391 GTCACAGGGGCCGCAGGCCCAGG - Exonic
1081831985 11:46121720-46121742 GTCCCGGGAGCCGCGGGCCGAGG - Intergenic
1083431875 11:62617429-62617451 GCCACAGGAGACGCAGGCAGTGG - Intronic
1085393561 11:76194762-76194784 GTCGCCGGAGGTGCAGGCCCGGG + Exonic
1092219041 12:6700530-6700552 GGGGCAGGAGGCGCAGGGCGCGG + Intronic
1095090551 12:38099981-38100003 GTCGGAGGAGCTGCAGCCCGGGG + Intergenic
1096106296 12:48998506-48998528 GTCGCAGGAGCGGGAGGCCAAGG - Exonic
1097191116 12:57220134-57220156 GCAGGAGGAGTCGCAGGGCGTGG + Intronic
1102068676 12:109999693-109999715 GTCGCCCGCGTCGCAGGCCGAGG - Exonic
1102453584 12:113057759-113057781 GCCGCAGGAGCAGCAGGCTGTGG + Exonic
1103577448 12:121888828-121888850 GTCTCTGGAGTCGCGGCCCGGGG + Exonic
1112054529 13:95677573-95677595 GCCGCAGGAGTCGGAGGAGGCGG + Intronic
1113976956 13:114234955-114234977 GCCCCAGGACTCGAAGGCCGCGG - Exonic
1114686152 14:24533770-24533792 GACACAGGAGTCTCAGGCCTGGG - Intergenic
1119759563 14:77141206-77141228 TTCGCCGGAGCCCCAGGCCGAGG - Intronic
1120740741 14:88106212-88106234 GTCGCAGTGGTTGCAGGCAGTGG + Intergenic
1121303738 14:92891920-92891942 GTGCCAGGAGTCCCAGGCTGTGG - Intergenic
1128319550 15:66683462-66683484 GTGGCATGAATCGCAGGCAGGGG + Intronic
1130849476 15:87779339-87779361 GAGGCAGGAGTTGGAGGCCGAGG + Intergenic
1133046148 16:3089430-3089452 GCCGCAGGTGTCGCAGGCGTGGG + Exonic
1133171903 16:3986981-3987003 GGGGCAGGAGTGGCAGGACGTGG - Intronic
1133756283 16:8764769-8764791 GGAGCAGGAGCCGCAGGCCATGG - Exonic
1139477553 16:67210229-67210251 GCCGCAGGTGCCGCAGGCCCCGG + Exonic
1139521062 16:67483030-67483052 GTTGCAGGAGGCTCAGGCCTTGG - Exonic
1139599603 16:67978677-67978699 GAGGCAGGAGTGGCAGGCCTAGG - Intronic
1141972509 16:87492949-87492971 GGCGGAGGAGGCGCCGGCCGAGG + Intergenic
1142240327 16:88941771-88941793 CTCGCAGCAGTCGGCGGCCGCGG + Intronic
1142687953 17:1588617-1588639 AGCTCAGGAGTCGGAGGCCGTGG + Intronic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1147819191 17:43231622-43231644 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147819777 17:43234653-43234675 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147821089 17:43242051-43242073 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147821895 17:43246540-43246562 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147825497 17:43267499-43267521 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147826628 17:43273966-43273988 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147827517 17:43278844-43278866 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147828625 17:43285005-43285027 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147830812 17:43297278-43297300 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147831511 17:43300907-43300929 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1147843461 17:43388796-43388818 GCCGCAGGAGACGCAGGCACAGG - Intergenic
1148759755 17:49993630-49993652 GTCGCAGGAGTCGCAGGCCGAGG - Intronic
1150220120 17:63491345-63491367 GTTGTAGAAGTCCCAGGCCGAGG - Exonic
1153316687 18:3729297-3729319 CGAGCTGGAGTCGCAGGCCGTGG - Exonic
1154344061 18:13527857-13527879 GCTGCAGGAGTGGCAGCCCGGGG - Intronic
1156668433 18:39437184-39437206 GTGGCAGGAGTGGAAGGCTGTGG - Intergenic
1160754825 19:751661-751683 GCGGAAGGAGTCTCAGGCCGGGG + Intronic
1160768840 19:821563-821585 GCCGCGGGCGCCGCAGGCCGTGG + Exonic
1161707261 19:5828005-5828027 GGCGCAGTCGTCGCAGCCCGAGG - Exonic
1167220379 19:48195288-48195310 GACGCAGCAGTCGCCGGCGGTGG - Exonic
1168332617 19:55579033-55579055 GTCGGAGGAGGCCGAGGCCGGGG - Exonic
1168641119 19:58032420-58032442 GTCCCAGGAGTGGCAGGGAGGGG - Intergenic
931253928 2:60554438-60554460 GAGGCAGGCGGCGCAGGCCGGGG + Intergenic
931669746 2:64636515-64636537 GTCGCAGGGGTGGGAGGACGGGG + Exonic
934994615 2:98945916-98945938 GGTGCAGGAGCCACAGGCCGAGG + Intergenic
946361403 2:219221127-219221149 GTCTCAGGAGCTCCAGGCCGGGG + Exonic
1171972481 20:31573022-31573044 GGCGCGGGAGGCGGAGGCCGAGG + Intronic
1174974471 20:55316293-55316315 ATCCCAGGAGTTGGAGGCCGTGG - Intergenic
1181035994 22:20169925-20169947 GTCGGGGGAGTCCCAGGCCAGGG + Intergenic
1181421560 22:22802891-22802913 GTAGAAGGAGACACAGGCCGTGG - Intronic
1184037643 22:41926272-41926294 GCCGCAGGAGTCGGTGGGCGCGG - Exonic
1184342189 22:43892031-43892053 GGCGCAGGTGACGCAGCCCGGGG - Intergenic
1184777152 22:46628903-46628925 GTCACAGGAGAGGCAGGCCGTGG + Intronic
1185182661 22:49372209-49372231 GTGGTCGGAGTCCCAGGCCGGGG + Intergenic
950224427 3:11222213-11222235 GTGGCAGGAGGCACAGGACGGGG + Intronic
954247043 3:49340135-49340157 GCTGCAGGAGCCGAAGGCCGCGG - Intronic
963335740 3:143972068-143972090 GCCGCCGGAGTCGGAGGGCGGGG + Exonic
968902476 4:3438168-3438190 GTGGCAGGAGCCCCAGGCCTGGG - Intronic
971248021 4:24948080-24948102 GGCGTAGGAGTGGCAGGCAGTGG + Intronic
971457870 4:26861053-26861075 GCCGGAGGAGTCGCCGGCGGCGG + Exonic
975682913 4:76895139-76895161 GAAGCAGGAGTCCCAGGCCTTGG - Exonic
991435953 5:66596994-66597016 GTCCCAGGAGGAGCAGGACGAGG + Exonic
993987012 5:94609696-94609718 GAGGCAGGAGTGGGAGGCCGAGG + Intronic
995025931 5:107422665-107422687 GTAGCAGAAGTCAGAGGCCGAGG + Intronic
1002648498 5:180674125-180674147 GTCGGAGGATTCCCAGGGCGGGG + Intergenic
1002785010 6:393506-393528 GTCGCCGGAGCCGCAGGAGGAGG + Intronic
1005136016 6:22570277-22570299 CTCCCAGGAGTGGCATGCCGAGG + Exonic
1006361189 6:33588278-33588300 GTCCCAGGAGTCACAGTCCTGGG + Intergenic
1006491548 6:34392393-34392415 GTCGCAGGAGTCGAGGGGTGGGG + Exonic
1006834143 6:36986408-36986430 GTGGCGGCAGCCGCAGGCCGGGG + Intergenic
1014724953 6:124962583-124962605 GCCCCAGGAGTCGCAGACCCTGG + Exonic
1019361381 7:605913-605935 GCCCCAGCAGTCGCAGCCCGGGG + Intronic
1019601251 7:1884840-1884862 GACGCAGGCGGGGCAGGCCGTGG + Intronic
1019621680 7:1995536-1995558 GGCGCAGGAGCCCCAGGCGGGGG + Intronic
1023393697 7:39733302-39733324 ATCCCTGGAGTCTCAGGCCGGGG - Intergenic
1024323181 7:48089355-48089377 GTCGCCGGTGTCGCAGTGCGAGG + Exonic
1026015789 7:66669737-66669759 GTCACAGGAGGGGCAGGCTGGGG - Intronic
1030033534 7:105389135-105389157 ATCGCAGGAGGCGGAGGCCCGGG - Intronic
1034270201 7:149799974-149799996 GTCGCTGGAGTCACAGGGTGTGG - Intergenic
1035453390 7:158993681-158993703 GTGGCAGGAGTCCCAGGGAGAGG - Intergenic
1041690053 8:60679277-60679299 GTCGCCGGCGTCGCCGCCCGCGG + Intronic
1042927018 8:73976630-73976652 CTTGCAGAAGTAGCAGGCCGAGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1049762372 8:144337164-144337186 CTCCCAGGAGACCCAGGCCGGGG - Intergenic
1056543354 9:87593068-87593090 GTTGCAAGAGTCACAGGCCCAGG - Intronic
1060964864 9:127706829-127706851 GGCCCAGGAGTCCCAGGCCATGG - Intronic
1189491443 X:41474203-41474225 TGCGCAGGCGCCGCAGGCCGCGG - Exonic
1195112255 X:101659683-101659705 GATGCGGGAGTCGGAGGCCGCGG - Intronic
1200224802 X:154411610-154411632 GTCGCCGGGGTCACAGGCCGTGG - Exonic