ID: 1148760700

View in Genome Browser
Species Human (GRCh38)
Location 17:49998309-49998331
Sequence CTGGGCACTGGCACAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148760695_1148760700 -7 Left 1148760695 17:49998293-49998315 CCAGGCATCATGCCACCTGGGCA No data
Right 1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG No data
1148760686_1148760700 22 Left 1148760686 17:49998264-49998286 CCCTGTTGAAGCAAGCTATTCCC No data
Right 1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG No data
1148760691_1148760700 1 Left 1148760691 17:49998285-49998307 CCTGGAACCCAGGCATCATGCCA No data
Right 1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG No data
1148760687_1148760700 21 Left 1148760687 17:49998265-49998287 CCTGTTGAAGCAAGCTATTCCCT No data
Right 1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG No data
1148760694_1148760700 -6 Left 1148760694 17:49998292-49998314 CCCAGGCATCATGCCACCTGGGC No data
Right 1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG No data
1148760690_1148760700 2 Left 1148760690 17:49998284-49998306 CCCTGGAACCCAGGCATCATGCC No data
Right 1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148760700 Original CRISPR CTGGGCACTGGCACAGCAGT GGG Intergenic
No off target data available for this crispr