ID: 1148762577

View in Genome Browser
Species Human (GRCh38)
Location 17:50014594-50014616
Sequence CCCTCAGAGAAACTCCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148762577_1148762586 9 Left 1148762577 17:50014594-50014616 CCCTAGTGGAGTTTCTCTGAGGG No data
Right 1148762586 17:50014626-50014648 CCTGCAGCAAGCTTCTGTCTGGG No data
1148762577_1148762584 8 Left 1148762577 17:50014594-50014616 CCCTAGTGGAGTTTCTCTGAGGG No data
Right 1148762584 17:50014625-50014647 CCCTGCAGCAAGCTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148762577 Original CRISPR CCCTCAGAGAAACTCCACTA GGG (reversed) Intergenic
No off target data available for this crispr