ID: 1148763305

View in Genome Browser
Species Human (GRCh38)
Location 17:50020758-50020780
Sequence AGTTCTACCCTGGTGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148763305_1148763311 27 Left 1148763305 17:50020758-50020780 CCAGCCAGCACCAGGGTAGAACT No data
Right 1148763311 17:50020808-50020830 CAGGTCCACATTGTCTCTCTGGG No data
1148763305_1148763308 8 Left 1148763305 17:50020758-50020780 CCAGCCAGCACCAGGGTAGAACT No data
Right 1148763308 17:50020789-50020811 AGAGCTCAAACAGTGTCACCAGG No data
1148763305_1148763310 26 Left 1148763305 17:50020758-50020780 CCAGCCAGCACCAGGGTAGAACT No data
Right 1148763310 17:50020807-50020829 CCAGGTCCACATTGTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148763305 Original CRISPR AGTTCTACCCTGGTGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr