ID: 1148763308

View in Genome Browser
Species Human (GRCh38)
Location 17:50020789-50020811
Sequence AGAGCTCAAACAGTGTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148763306_1148763308 4 Left 1148763306 17:50020762-50020784 CCAGCACCAGGGTAGAACTCACT No data
Right 1148763308 17:50020789-50020811 AGAGCTCAAACAGTGTCACCAGG No data
1148763304_1148763308 14 Left 1148763304 17:50020752-50020774 CCTCTGCCAGCCAGCACCAGGGT No data
Right 1148763308 17:50020789-50020811 AGAGCTCAAACAGTGTCACCAGG No data
1148763305_1148763308 8 Left 1148763305 17:50020758-50020780 CCAGCCAGCACCAGGGTAGAACT No data
Right 1148763308 17:50020789-50020811 AGAGCTCAAACAGTGTCACCAGG No data
1148763301_1148763308 17 Left 1148763301 17:50020749-50020771 CCACCTCTGCCAGCCAGCACCAG No data
Right 1148763308 17:50020789-50020811 AGAGCTCAAACAGTGTCACCAGG No data
1148763307_1148763308 -2 Left 1148763307 17:50020768-50020790 CCAGGGTAGAACTCACTTTGAAG No data
Right 1148763308 17:50020789-50020811 AGAGCTCAAACAGTGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148763308 Original CRISPR AGAGCTCAAACAGTGTCACC AGG Intergenic
No off target data available for this crispr