ID: 1148763311

View in Genome Browser
Species Human (GRCh38)
Location 17:50020808-50020830
Sequence CAGGTCCACATTGTCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148763305_1148763311 27 Left 1148763305 17:50020758-50020780 CCAGCCAGCACCAGGGTAGAACT No data
Right 1148763311 17:50020808-50020830 CAGGTCCACATTGTCTCTCTGGG No data
1148763307_1148763311 17 Left 1148763307 17:50020768-50020790 CCAGGGTAGAACTCACTTTGAAG No data
Right 1148763311 17:50020808-50020830 CAGGTCCACATTGTCTCTCTGGG No data
1148763306_1148763311 23 Left 1148763306 17:50020762-50020784 CCAGCACCAGGGTAGAACTCACT No data
Right 1148763311 17:50020808-50020830 CAGGTCCACATTGTCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148763311 Original CRISPR CAGGTCCACATTGTCTCTCT GGG Intergenic
No off target data available for this crispr