ID: 1148764507

View in Genome Browser
Species Human (GRCh38)
Location 17:50029265-50029287
Sequence GGAGGTGACCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148764507_1148764519 16 Left 1148764507 17:50029265-50029287 CCCTCTGCCCTCTGGTCACCTCC No data
Right 1148764519 17:50029304-50029326 TGTGGTGGCCGAAGTGGAGCTGG No data
1148764507_1148764522 24 Left 1148764507 17:50029265-50029287 CCCTCTGCCCTCTGGTCACCTCC No data
Right 1148764522 17:50029312-50029334 CCGAAGTGGAGCTGGGCTCCAGG No data
1148764507_1148764520 17 Left 1148764507 17:50029265-50029287 CCCTCTGCCCTCTGGTCACCTCC No data
Right 1148764520 17:50029305-50029327 GTGGTGGCCGAAGTGGAGCTGGG No data
1148764507_1148764515 1 Left 1148764507 17:50029265-50029287 CCCTCTGCCCTCTGGTCACCTCC No data
Right 1148764515 17:50029289-50029311 AGCTCCTGACCACAGTGTGGTGG No data
1148764507_1148764513 -2 Left 1148764507 17:50029265-50029287 CCCTCTGCCCTCTGGTCACCTCC No data
Right 1148764513 17:50029286-50029308 CCCAGCTCCTGACCACAGTGTGG No data
1148764507_1148764518 10 Left 1148764507 17:50029265-50029287 CCCTCTGCCCTCTGGTCACCTCC No data
Right 1148764518 17:50029298-50029320 CCACAGTGTGGTGGCCGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148764507 Original CRISPR GGAGGTGACCAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr