ID: 1148766087

View in Genome Browser
Species Human (GRCh38)
Location 17:50039132-50039154
Sequence CAGCCTGACTGGCCCTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148766084_1148766087 5 Left 1148766084 17:50039104-50039126 CCTTGGGACGGGACAAGACACTC No data
Right 1148766087 17:50039132-50039154 CAGCCTGACTGGCCCTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148766087 Original CRISPR CAGCCTGACTGGCCCTGATC AGG Intergenic
No off target data available for this crispr