ID: 1148767196

View in Genome Browser
Species Human (GRCh38)
Location 17:50046309-50046331
Sequence AGCCCAAAGGGACCACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148767196_1148767204 13 Left 1148767196 17:50046309-50046331 CCACCTTGTGGTCCCTTTGGGCT No data
Right 1148767204 17:50046345-50046367 GTAGCTCCAACCCTATCCCAGGG No data
1148767196_1148767203 12 Left 1148767196 17:50046309-50046331 CCACCTTGTGGTCCCTTTGGGCT No data
Right 1148767203 17:50046344-50046366 TGTAGCTCCAACCCTATCCCAGG No data
1148767196_1148767206 20 Left 1148767196 17:50046309-50046331 CCACCTTGTGGTCCCTTTGGGCT No data
Right 1148767206 17:50046352-50046374 CAACCCTATCCCAGGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148767196 Original CRISPR AGCCCAAAGGGACCACAAGG TGG (reversed) Intergenic
No off target data available for this crispr