ID: 1148767205

View in Genome Browser
Species Human (GRCh38)
Location 17:50046351-50046373
Sequence CAAAGACCCTGGGATAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148767205_1148767212 4 Left 1148767205 17:50046351-50046373 CCAACCCTATCCCAGGGTCTTTG No data
Right 1148767212 17:50046378-50046400 ATTGCCAGCTCCAGCTTCTAGGG No data
1148767205_1148767215 14 Left 1148767205 17:50046351-50046373 CCAACCCTATCCCAGGGTCTTTG No data
Right 1148767215 17:50046388-50046410 CCAGCTTCTAGGGCTTCTCCAGG No data
1148767205_1148767216 26 Left 1148767205 17:50046351-50046373 CCAACCCTATCCCAGGGTCTTTG No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767205_1148767211 3 Left 1148767205 17:50046351-50046373 CCAACCCTATCCCAGGGTCTTTG No data
Right 1148767211 17:50046377-50046399 AATTGCCAGCTCCAGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148767205 Original CRISPR CAAAGACCCTGGGATAGGGT TGG (reversed) Intergenic