ID: 1148767207

View in Genome Browser
Species Human (GRCh38)
Location 17:50046355-50046377
Sequence TTGCCAAAGACCCTGGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148767207_1148767216 22 Left 1148767207 17:50046355-50046377 CCCTATCCCAGGGTCTTTGGCAA No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767207_1148767212 0 Left 1148767207 17:50046355-50046377 CCCTATCCCAGGGTCTTTGGCAA No data
Right 1148767212 17:50046378-50046400 ATTGCCAGCTCCAGCTTCTAGGG No data
1148767207_1148767211 -1 Left 1148767207 17:50046355-50046377 CCCTATCCCAGGGTCTTTGGCAA No data
Right 1148767211 17:50046377-50046399 AATTGCCAGCTCCAGCTTCTAGG No data
1148767207_1148767215 10 Left 1148767207 17:50046355-50046377 CCCTATCCCAGGGTCTTTGGCAA No data
Right 1148767215 17:50046388-50046410 CCAGCTTCTAGGGCTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148767207 Original CRISPR TTGCCAAAGACCCTGGGATA GGG (reversed) Intergenic