ID: 1148767210

View in Genome Browser
Species Human (GRCh38)
Location 17:50046362-50046384
Sequence TGGCAATTTGCCAAAGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148767210_1148767215 3 Left 1148767210 17:50046362-50046384 CCAGGGTCTTTGGCAAATTGCCA No data
Right 1148767215 17:50046388-50046410 CCAGCTTCTAGGGCTTCTCCAGG No data
1148767210_1148767216 15 Left 1148767210 17:50046362-50046384 CCAGGGTCTTTGGCAAATTGCCA No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767210_1148767212 -7 Left 1148767210 17:50046362-50046384 CCAGGGTCTTTGGCAAATTGCCA No data
Right 1148767212 17:50046378-50046400 ATTGCCAGCTCCAGCTTCTAGGG No data
1148767210_1148767220 29 Left 1148767210 17:50046362-50046384 CCAGGGTCTTTGGCAAATTGCCA No data
Right 1148767220 17:50046414-50046436 TAGAAGTGGTAGAGACTTCCTGG No data
1148767210_1148767211 -8 Left 1148767210 17:50046362-50046384 CCAGGGTCTTTGGCAAATTGCCA No data
Right 1148767211 17:50046377-50046399 AATTGCCAGCTCCAGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148767210 Original CRISPR TGGCAATTTGCCAAAGACCC TGG (reversed) Intergenic