ID: 1148767213 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:50046382-50046404 |
| Sequence | GAAGCCCTAGAAGCTGGAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148767213_1148767216 | -5 | Left | 1148767213 | 17:50046382-50046404 | CCAGCTCCAGCTTCTAGGGCTTC | No data | ||
| Right | 1148767216 | 17:50046400-50046422 | GCTTCTCCAGGCCCTAGAAGTGG | No data | ||||
| 1148767213_1148767220 | 9 | Left | 1148767213 | 17:50046382-50046404 | CCAGCTCCAGCTTCTAGGGCTTC | No data | ||
| Right | 1148767220 | 17:50046414-50046436 | TAGAAGTGGTAGAGACTTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148767213 | Original CRISPR | GAAGCCCTAGAAGCTGGAGC TGG (reversed) | Intergenic | ||