ID: 1148767213

View in Genome Browser
Species Human (GRCh38)
Location 17:50046382-50046404
Sequence GAAGCCCTAGAAGCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148767213_1148767216 -5 Left 1148767213 17:50046382-50046404 CCAGCTCCAGCTTCTAGGGCTTC No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767213_1148767220 9 Left 1148767213 17:50046382-50046404 CCAGCTCCAGCTTCTAGGGCTTC No data
Right 1148767220 17:50046414-50046436 TAGAAGTGGTAGAGACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148767213 Original CRISPR GAAGCCCTAGAAGCTGGAGC TGG (reversed) Intergenic