ID: 1148767216

View in Genome Browser
Species Human (GRCh38)
Location 17:50046400-50046422
Sequence GCTTCTCCAGGCCCTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148767207_1148767216 22 Left 1148767207 17:50046355-50046377 CCCTATCCCAGGGTCTTTGGCAA No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767213_1148767216 -5 Left 1148767213 17:50046382-50046404 CCAGCTCCAGCTTCTAGGGCTTC No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767210_1148767216 15 Left 1148767210 17:50046362-50046384 CCAGGGTCTTTGGCAAATTGCCA No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767209_1148767216 16 Left 1148767209 17:50046361-50046383 CCCAGGGTCTTTGGCAAATTGCC No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767208_1148767216 21 Left 1148767208 17:50046356-50046378 CCTATCCCAGGGTCTTTGGCAAA No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data
1148767205_1148767216 26 Left 1148767205 17:50046351-50046373 CCAACCCTATCCCAGGGTCTTTG No data
Right 1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148767216 Original CRISPR GCTTCTCCAGGCCCTAGAAG TGG Intergenic