ID: 1148767843

View in Genome Browser
Species Human (GRCh38)
Location 17:50049582-50049604
Sequence CGTTGTATGCTGAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148767840_1148767843 -8 Left 1148767840 17:50049567-50049589 CCATCTCAGGGATGGCGTTGTAT No data
Right 1148767843 17:50049582-50049604 CGTTGTATGCTGAGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148767843 Original CRISPR CGTTGTATGCTGAGGGCAGC AGG Intergenic
No off target data available for this crispr