ID: 1148769064

View in Genome Browser
Species Human (GRCh38)
Location 17:50056498-50056520
Sequence GCCGCCGGCCGCCACCATCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148769064_1148769074 29 Left 1148769064 17:50056498-50056520 CCTTGATGGTGGCGGCCGGCGGC 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1148769074 17:50056550-50056572 CCGATTCCTGGTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 89
1148769064_1148769066 2 Left 1148769064 17:50056498-50056520 CCTTGATGGTGGCGGCCGGCGGC 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1148769066 17:50056523-50056545 CGTCGTCTCCGCCTTCAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
1148769064_1148769069 17 Left 1148769064 17:50056498-50056520 CCTTGATGGTGGCGGCCGGCGGC 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1148769069 17:50056538-50056560 CAACCTGGATACCCGATTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 41
1148769064_1148769071 26 Left 1148769064 17:50056498-50056520 CCTTGATGGTGGCGGCCGGCGGC 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1148769071 17:50056547-50056569 TACCCGATTCCTGGTAGTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148769064 Original CRISPR GCCGCCGGCCGCCACCATCA AGG (reversed) Exonic
900349777 1:2228765-2228787 GCCGCCTGCCGCCGCCTCCATGG - Exonic
902719358 1:18293808-18293830 GCCACCCGCTGCCACCAGCAAGG + Intronic
902747440 1:18482990-18483012 GCCGTTGACCGCCACCATCTCGG - Exonic
903448516 1:23437372-23437394 GCCGCCGGCCCCCACCCACAAGG + Intronic
904110331 1:28121315-28121337 GCTGCCGGCCGCCATCATGCTGG - Intergenic
905449154 1:38046204-38046226 ACCGCCCGCCGCCAGCATCCCGG + Exonic
912551741 1:110489495-110489517 GCCGCCAGGCCCCACCAGCAGGG - Intergenic
914730405 1:150364707-150364729 GCCGCCGGCCGCCATCTTCCCGG - Exonic
917110184 1:171539563-171539585 GCCCCTGGCAGCCACCATTATGG + Intronic
921355504 1:214281239-214281261 GCGCCCCGCCGCCACCATGAGGG + Exonic
1075333947 10:121596060-121596082 GCCGCTGGCGGCCACAATCCCGG + Intronic
1076667711 10:132102519-132102541 GCCGCCGGCCTCCACCTGGATGG - Intergenic
1076993735 11:288807-288829 GCCCCCGGCCGCCTCCACCTGGG - Intergenic
1077093104 11:788405-788427 GCCGCCAGCAGCCCCCACCACGG - Exonic
1083176110 11:60951451-60951473 GCCGCCCGCCGCCACCGTCGAGG + Exonic
1083895188 11:65616252-65616274 GCCGGGGGCCGCCCCCATGAGGG + Exonic
1084049936 11:66593019-66593041 GCCGGCGGCCGCCACCGTCCAGG + Exonic
1088484568 11:110328418-110328440 GGAGCCGGCCGCCACCATCTCGG - Intergenic
1089249105 11:117144687-117144709 GCCGCCGGCCGGCGCCTCCACGG + Intronic
1096680420 12:53252106-53252128 GCCTCTGGCCGCCGCCATGATGG - Intronic
1102543363 12:113638063-113638085 CCCGCCGGCCGCCCGCATCTGGG + Intergenic
1102953765 12:117046574-117046596 CACGCTGGCCGCCTCCATCATGG + Exonic
1106708983 13:32311413-32311435 GCCAGCCGCAGCCACCATCACGG - Exonic
1113707792 13:112445570-112445592 GCCGCCTGCCGCCCCCTCCATGG - Intergenic
1114069770 14:19097718-19097740 GCCGCCGCCGGCCACCGTCGTGG + Intergenic
1114092492 14:19302285-19302307 GCCGCCGCCGGCCACCGTCGTGG - Intergenic
1115474597 14:33800740-33800762 GACCCTGGCCGCCACCAGCACGG + Exonic
1128269173 15:66293720-66293742 GCCGCCTGCAGCCACGGTCAGGG + Exonic
1129702543 15:77776050-77776072 GCCTGTGGCCGCCACCACCACGG + Intronic
1131215046 15:90529752-90529774 GCCGCCGGCGGCCACCTGGAGGG - Intergenic
1132829033 16:1918545-1918567 GCCGGCAGCCGCCACCACCCGGG + Intergenic
1133781143 16:8940451-8940473 GAAGCTGGGCGCCACCATCAAGG + Intronic
1134092320 16:11398224-11398246 GCAGCCAGACGCCACCATCGTGG - Intronic
1135133595 16:19872006-19872028 GCCGCTGGCCGCCAGCGTGATGG + Exonic
1139848478 16:69936571-69936593 CCCACCAGCAGCCACCATCAAGG - Intronic
1141608811 16:85170098-85170120 GCCGCCAGCCCCCACCAGGACGG + Intergenic
1141947057 16:87317625-87317647 GCCGCCGGCCGCCCCAGCCAGGG + Intronic
1144511675 17:15882245-15882267 GCCACCGGCCACCACCTCCAGGG - Intergenic
1145765541 17:27456331-27456353 GCCGCCGGCCTCCGCCCTCGGGG - Intergenic
1148769064 17:50056498-50056520 GCCGCCGGCCGCCACCATCAAGG - Exonic
1152130818 17:78475377-78475399 GCCGCCCACCCCCACCAGCAGGG + Exonic
1152491949 17:80640901-80640923 GCCGCGGGCCGCGACCATGCTGG + Intronic
1155053200 18:22165640-22165662 GCCGCCGGCGGCCGCCAGCACGG - Intergenic
1160516196 18:79480471-79480493 ACTGCCGGCCGCCAGCATCCTGG + Intronic
1161108760 19:2456870-2456892 GCCGCGAGCCGCCGCCACCATGG - Exonic
1161389992 19:4015820-4015842 GCCGCCGGCCGGCTCCAGGATGG + Intronic
1162465343 19:10836174-10836196 CGCGCCGGCCGCCATCATCCGGG + Exonic
1167849344 19:52190092-52190114 GCCGTCGGCCGCCGCCATCTTGG - Exonic
933460529 2:82577982-82578004 GGCGCCCGCCGCCACCATGCAGG - Intergenic
945080945 2:206085712-206085734 GCCCCCGGCCTCCACCACCCGGG + Intronic
1169216214 20:3796233-3796255 GCCGCCGGACGCCACCAATGGGG - Exonic
1172269359 20:33645000-33645022 GCCGCCTGCCGCCTCCAGCCTGG - Exonic
1175388763 20:58613581-58613603 GCGGCCGGCCAACACCATCAGGG + Intergenic
1176104449 20:63379353-63379375 CCCGACGGCAGCCAGCATCATGG - Intergenic
1178485300 21:33015726-33015748 TCCTCCAGCCTCCACCATCACGG + Intergenic
1178493826 21:33070845-33070867 GGCGCCGGGCGCCAGCAGCACGG - Exonic
1180488237 22:15820281-15820303 GCCGCCGCCGGCCACCGTCGTGG + Intergenic
1182421181 22:30249274-30249296 GCCCCCGGCCGGCTCCCTCATGG + Intergenic
1183050512 22:35257503-35257525 GCCGCCGATCGCCGCCATCTTGG - Exonic
1183359185 22:37374661-37374683 GCCGCCGGCCTCGTCCACCACGG - Exonic
1184101588 22:42343974-42343996 GCCGCCCGCCGCCTCCATCCGGG - Intergenic
1184226055 22:43129353-43129375 GCAGCAGGCCGCCACCTCCAGGG - Exonic
1184439143 22:44498077-44498099 GCCGCCGGCCGTGACCAAGATGG + Exonic
1185366449 22:50439093-50439115 CAGGCCGGCCGCCACCTTCATGG + Intronic
950007982 3:9703820-9703842 GCCGCCGGCGGCCACTGTCAGGG + Exonic
951217594 3:20040074-20040096 GCCGGCGGCTGCCAGCCTCACGG - Exonic
956675103 3:71725501-71725523 CCCGCCGCCCGCCGCCTTCAGGG + Intronic
961012809 3:123447709-123447731 GCCGACGGCGGCCGCCAGCACGG + Exonic
962222304 3:133574005-133574027 GCCGCCGGCCCCACCCATCCGGG + Exonic
963904484 3:150762732-150762754 CCCGGCCGCCGCCACCATCTCGG - Exonic
965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG + Intergenic
966743185 3:183253141-183253163 CCCGCCAGCCGCCACCCTCCCGG - Intronic
969536626 4:7760367-7760389 GCCGCCGCCCGCCAGCCCCAAGG + Exonic
973299473 4:48563980-48564002 GCAGCCGGCCGCCACCCTCCCGG + Exonic
975420457 4:74158137-74158159 GCCGCGGACCGGCACCGTCATGG - Exonic
980595072 4:134944256-134944278 GACCCCGGCCGCCGCCATGATGG + Intergenic
983094201 4:163542694-163542716 ACTGCTGGCCTCCACCATCAGGG + Intronic
992317213 5:75568420-75568442 GTGGCCGGCCTCCACTATCAAGG - Intronic
993846748 5:92953632-92953654 GCTGCTGGCTGCCACCACCAGGG - Intergenic
999394573 5:151219123-151219145 GCCCCCTGCCCCAACCATCATGG - Intronic
1002263752 5:178014923-178014945 GTAGCCCGCCGCCAACATCAAGG - Intronic
1005453037 6:25992503-25992525 GCCGCCCGCCGCCAGACTCAGGG + Intergenic
1017028944 6:150204106-150204128 CCAGGCGGCCGCCACCCTCACGG - Intronic
1019701046 7:2475205-2475227 GCCGCTGGGCGCCACCACCAGGG - Exonic
1019707759 7:2504698-2504720 GCCGACGCCCTCCACCAGCACGG + Intergenic
1023411745 7:39894848-39894870 GCCACGGGCTGCCACCAACAAGG + Intergenic
1030336870 7:108337780-108337802 GAAGCCGCCCGCCACCATCTTGG + Intronic
1034249552 7:149677168-149677190 GGAGCCGCCCGCCACCATCTTGG + Intergenic
1034650783 7:152688513-152688535 GAAGCAGCCCGCCACCATCATGG - Intergenic
1035608694 8:946853-946875 GCTGCTGGCAGCCACCGTCAGGG - Intergenic
1035865098 8:3074023-3074045 GCAGCCCGCTGCCACCCTCAGGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036910782 8:12755444-12755466 GCCGCCCGCCGCCACGGTCCCGG + Exonic
1039379061 8:37067818-37067840 GCTGCCGGGCACCACCACCAAGG + Intergenic
1045516311 8:102863670-102863692 GCGGCCGGCCGCCTCGAACATGG - Intronic
1045815501 8:106271815-106271837 GCCGCCGGCTGCGACCACCGTGG + Intronic
1048214085 8:132480314-132480336 GCCGCCGCCCTCCAGCAGCAGGG + Exonic
1049308600 8:141921197-141921219 GCCACAGCCAGCCACCATCAGGG + Intergenic
1049776740 8:144409441-144409463 GCCGCCAGCCGCCCGCATCCCGG - Intergenic
1061257771 9:129462605-129462627 GGAGCCGGCAGCCACCAGCAAGG + Intergenic
1061602230 9:131678796-131678818 GCCCCCGGCACCCCCCATCATGG - Intronic
1186496552 X:10015910-10015932 GCCGCCGGCCGGCGCCACCGCGG + Intronic