ID: 1148770235

View in Genome Browser
Species Human (GRCh38)
Location 17:50062265-50062287
Sequence CTCAGGGCTCAGAGAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 6, 3: 57, 4: 494}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148770231_1148770235 -4 Left 1148770231 17:50062246-50062268 CCATTTTACAGATGGGGCACTCA 0: 1
1: 4
2: 44
3: 230
4: 1267
Right 1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG 0: 1
1: 1
2: 6
3: 57
4: 494
1148770223_1148770235 25 Left 1148770223 17:50062217-50062239 CCTGGAGGTCAGCAGGAGAGGGG 0: 1
1: 0
2: 4
3: 51
4: 510
Right 1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG 0: 1
1: 1
2: 6
3: 57
4: 494
1148770229_1148770235 -2 Left 1148770229 17:50062244-50062266 CCCCATTTTACAGATGGGGCACT 0: 1
1: 13
2: 106
3: 759
4: 3336
Right 1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG 0: 1
1: 1
2: 6
3: 57
4: 494
1148770228_1148770235 -1 Left 1148770228 17:50062243-50062265 CCCCCATTTTACAGATGGGGCAC 0: 1
1: 2
2: 59
3: 393
4: 1429
Right 1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG 0: 1
1: 1
2: 6
3: 57
4: 494
1148770230_1148770235 -3 Left 1148770230 17:50062245-50062267 CCCATTTTACAGATGGGGCACTC 0: 1
1: 4
2: 44
3: 323
4: 1959
Right 1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG 0: 1
1: 1
2: 6
3: 57
4: 494
1148770221_1148770235 26 Left 1148770221 17:50062216-50062238 CCCTGGAGGTCAGCAGGAGAGGG 0: 1
1: 0
2: 10
3: 48
4: 385
Right 1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG 0: 1
1: 1
2: 6
3: 57
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148770235 Original CRISPR CTCAGGGCTCAGAGAAGGAA AGG Intronic
900704835 1:4073953-4073975 CTCAGGGCTCACAGGAGGACTGG - Intergenic
901465813 1:9420334-9420356 CTCAGGCCCCAAAGAAAGAAAGG + Intergenic
901556333 1:10033783-10033805 CTTTGGGCTTGGAGAAGGAACGG + Intronic
901712902 1:11129720-11129742 CTCAGGTATCAGAGAAGGGAAGG - Exonic
902362433 1:15949554-15949576 CTCAGGCCTCAGAGAAGAGGAGG - Intronic
902374546 1:16024154-16024176 CAGAGAGCTCAGAGGAGGAAGGG - Intronic
902387787 1:16085658-16085680 TTCAGGGCTGAGTGAAGGCAAGG + Intergenic
902570069 1:17341660-17341682 CTCAGGAATGAGTGAAGGAATGG + Intronic
902619243 1:17641011-17641033 CTGAGGTCACACAGAAGGAAGGG + Intronic
902732281 1:18377328-18377350 TTCAGAGCTCAGGGAAGGAATGG - Intronic
903378651 1:22882246-22882268 CTGTGGGATCAGAGAGGGAAGGG - Intronic
904200639 1:28817006-28817028 CTCGGGGCGCAGAGGAGGCAGGG - Intronic
904391365 1:30188461-30188483 CACAGGGGTCAGAGCAGGAGGGG - Intergenic
905094763 1:35460150-35460172 CATAGGGCTCAGAGAACCAATGG + Intronic
905363033 1:37433479-37433501 CTCAAGGCTGAGAGAAGGTGGGG - Intergenic
905684332 1:39898138-39898160 GTAAGGGCACAGTGAAGGAAAGG + Intronic
905730977 1:40299534-40299556 TGCAGGGCACAGAGGAGGAAGGG - Intergenic
905746672 1:40424059-40424081 CTCAGGTCCCAGCGTAGGAAGGG - Intergenic
905753904 1:40490472-40490494 GCAAGGGCTCAGTGAAGGAAAGG - Intronic
906251420 1:44313685-44313707 ATCAAGGCTCAGAGAAGGGGTGG - Intronic
906681059 1:47725640-47725662 CTGAGGGCTCAGAAAGGGGAAGG - Intergenic
907245229 1:53104064-53104086 CTCTGGGGGCAGAGAGGGAAAGG - Intronic
907321274 1:53603907-53603929 GCTAAGGCTCAGAGAAGGAAAGG + Intronic
907427277 1:54388331-54388353 GCCAGGGCTCAGAGAAGTGAAGG - Intronic
907598791 1:55745831-55745853 CTCAGGGCCCAGACAGAGAATGG - Intergenic
907928633 1:58978536-58978558 CTCTGTGCTCAGAGGAGGTAAGG - Intergenic
908543852 1:65146567-65146589 CCCAGGACTCAGAGAAGGTGAGG - Intergenic
908880419 1:68725405-68725427 CTCAGGGGTGGGGGAAGGAAGGG - Intergenic
909706476 1:78590941-78590963 CACTGGGCTCAGAGAAGTTAAGG + Intergenic
912130532 1:106594587-106594609 CTTAGGGTTCAGAGTAGGTATGG + Intergenic
912437276 1:109670596-109670618 GTCATGGGTCAGAGATGGAAGGG - Intronic
912512576 1:110198993-110199015 CTCAGGGCTCAGACTTGGGAGGG + Exonic
912701581 1:111882128-111882150 ACCAGAGCTCAGAGAGGGAAGGG - Intronic
912789055 1:112633234-112633256 CTGAGGGGTCAGGGAAGGGATGG - Intronic
913118413 1:115717651-115717673 CACACGGCTAAGAGAAGAAAAGG - Intronic
914431860 1:147625880-147625902 CTCTTGGCTCTGAGAGGGAAAGG + Exonic
914434603 1:147648752-147648774 CCCATGGCTGAGAGTAGGAAGGG - Intronic
915083333 1:153367032-153367054 CTGAGGGCTCTGTGAAGGCAGGG - Intergenic
915552942 1:156645796-156645818 ATAAAGGCTCAGAGAAGGTAAGG + Intronic
915785429 1:158606633-158606655 AGCAGGTCTCAGAGAAGGATAGG - Exonic
916079795 1:161225294-161225316 CTTGGGACTCAGGGAAGGAAGGG + Intergenic
916610939 1:166390873-166390895 CTCAGACCTCAGAGAAAGGAAGG + Intergenic
917408875 1:174737530-174737552 TGGAGGGCTCAGAGAAAGAAAGG - Intronic
918238661 1:182603188-182603210 CTCAGGGCTCCGAGAGGGAAGGG - Intronic
918955275 1:191199268-191199290 CTCAGGACTACTAGAAGGAAAGG - Intergenic
919761838 1:201102928-201102950 CTGGGAGGTCAGAGAAGGAAGGG + Intronic
920258293 1:204671599-204671621 ATCTGGACTCAGAGAAGGGAAGG + Intronic
921174681 1:212583739-212583761 CTCAGGGCACAGAGGAGGGCAGG + Intronic
921544666 1:216460389-216460411 GCCAGGGCTCAGAGAAGGCATGG - Intergenic
924286101 1:242488573-242488595 CCAAGGGCTCAGGGGAGGAAGGG + Intronic
1063083039 10:2786578-2786600 CTCAGGGCTGAGAGAAGATAAGG + Intergenic
1063364937 10:5484975-5484997 ATCAGGTCTCAAAAAAGGAAGGG + Intergenic
1063366906 10:5496584-5496606 CTCAGGGCTCTGAACAGGAAGGG - Intergenic
1063999878 10:11654739-11654761 CTCTGTGCTGAGAGAAGGCAGGG - Intergenic
1064254486 10:13732451-13732473 CTCTGGGCTCTGAAAAGGAGAGG + Intronic
1065235645 10:23648906-23648928 CTGGGAGTTCAGAGAAGGAAAGG - Intergenic
1066179779 10:32949412-32949434 CTCAGGGCACAGAAATGGAAAGG + Intronic
1067099864 10:43326636-43326658 CTCTGGGCCCAGAGCTGGAAAGG - Intergenic
1067279351 10:44859593-44859615 CTCAGGGCGCTGGGATGGAAGGG - Intergenic
1067785541 10:49242908-49242930 CACAGGGACCAGAGAAGCAATGG + Intergenic
1068317144 10:55360676-55360698 CTCAAGGCTCAAACAATGAATGG + Intronic
1068704993 10:60065291-60065313 CTTAGGAGTCAGAGAAGGGAAGG + Intronic
1069075499 10:64034597-64034619 CTCAAGGCTGGGAGAAGGGAAGG + Intergenic
1069098495 10:64289044-64289066 GTCAGAGCACAGAGGAGGAATGG + Intergenic
1069112154 10:64461319-64461341 CTCAGGGCATAGGGAAAGAAGGG + Intergenic
1069614641 10:69799273-69799295 TTCAGGGCTCCCAGAAGAAAGGG - Intergenic
1069847150 10:71380201-71380223 CTGTGGGCCCAGAGAAGGCAGGG - Intergenic
1070045749 10:72834541-72834563 CTTAGGGGTCAGAGAGAGAAAGG + Intronic
1070277819 10:75024427-75024449 TTCAGGGCTATGAAAAGGAAAGG - Intronic
1070987611 10:80701858-80701880 CCCAGGGATCAGAGAGGGAAGGG + Intergenic
1071082034 10:81824083-81824105 TCTAGTGCTCAGAGAAGGAAAGG - Intergenic
1072048665 10:91682045-91682067 CTCAGGGCACAGACAGGGAGGGG - Intergenic
1072616035 10:97049406-97049428 CCCAGGGCAGAGAGAGGGAAAGG - Intronic
1074128568 10:110552450-110552472 CCTTGGCCTCAGAGAAGGAATGG - Intergenic
1074531965 10:114304536-114304558 CTCTGAGGTCAGAAAAGGAATGG + Intronic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1075443463 10:122497592-122497614 CTCAGGGCTCAGGGAGGCAAAGG - Intronic
1075948614 10:126458604-126458626 CTCTGAGCTCACAGCAGGAAAGG + Intronic
1076032848 10:127174194-127174216 CTCAGGGCTCGCAGAGTGAAGGG + Intronic
1076066402 10:127451478-127451500 CTCAGGGGACACAGAAGGAGAGG - Exonic
1076896829 10:133317233-133317255 CCCAGGACACAGAGATGGAAAGG + Intronic
1077329701 11:1978805-1978827 GTCAGGGCCCTGAGGAGGAAGGG + Intronic
1077336802 11:2008938-2008960 CTCAGAGTTCAGAGTTGGAAAGG + Intergenic
1077457073 11:2687679-2687701 CTCAGGGTTCAGTGTTGGAATGG + Intronic
1077497157 11:2891893-2891915 CTCCAGGGTCAGAGAAGGAGGGG + Intronic
1077633514 11:3826720-3826742 CTTAGGGCTCAGAAAGGGAGAGG - Intergenic
1077739649 11:4831299-4831321 CTCAGTGAGCAGAGGAGGAAGGG - Intronic
1078364317 11:10693777-10693799 CTCAGGGCTCAGGGCAGGCTGGG + Intronic
1079301722 11:19284519-19284541 CTCAGGGGTGGCAGAAGGAAGGG - Intergenic
1079520859 11:21324920-21324942 CTCAGGAGACAGAGAAGAAAGGG - Intronic
1079584481 11:22108776-22108798 TTCAGGGCTGAGAAAAGGAGAGG + Intergenic
1079746263 11:24134857-24134879 CTGTGAGCTCGGAGAAGGAATGG - Intergenic
1080121746 11:28685773-28685795 CTCAGGGGTGAGAGATGCAAAGG + Intergenic
1080648499 11:34204473-34204495 CTCAGGGCTGGGGGAAGGCAGGG - Intronic
1080709259 11:34731197-34731219 CACTGGGCTCTGGGAAGGAAGGG - Intergenic
1080842066 11:35993310-35993332 CTCAGGGCACAGAGAAGGGCTGG + Intronic
1081074367 11:38651366-38651388 ATCAGAGATCAGAGATGGAAAGG + Intergenic
1081532512 11:43972210-43972232 TTGATGGTTCAGAGAAGGAAGGG + Intergenic
1081641842 11:44761296-44761318 TTTAGGGCTAAGAGCAGGAACGG - Intronic
1082822907 11:57556720-57556742 CTGAGGCCTCAGAGCAGGATGGG + Intronic
1082921489 11:58499476-58499498 CTTAGGGGGCAGGGAAGGAAAGG + Intergenic
1083397254 11:62400394-62400416 GCCAGGGCTCAGAAAAGGAACGG - Intergenic
1083420112 11:62547537-62547559 GGCGGCGCTCAGAGAAGGAATGG - Intronic
1083429328 11:62605824-62605846 TTAAGGGCTCAGGGGAGGAAGGG - Intronic
1083472364 11:62892567-62892589 CTGAGGGCTCAGAGAAGTAAAGG + Intergenic
1083796329 11:65018837-65018859 GTGGGGGCCCAGAGAAGGAAGGG - Intronic
1084010275 11:66344612-66344634 CTCAACACTCAGAGCAGGAATGG - Intronic
1084382184 11:68819835-68819857 CTCATGGCTCAAAGAGGGAGAGG - Intronic
1084479497 11:69410499-69410521 CTGTGGGATCAGAGGAGGAAGGG + Intergenic
1085067543 11:73511050-73511072 CTCGTGGCCCAGAAAAGGAAAGG + Intronic
1085233222 11:74990664-74990686 GTTAGGGCTCAGAACAGGAAAGG - Intronic
1085317940 11:75557232-75557254 CTCAGAGGACAGAGCAGGAATGG + Intergenic
1085509584 11:77081523-77081545 CTCAGGGCACAGAGCATGAAAGG + Intronic
1085782224 11:79419822-79419844 CTGAAGGCCCAGAGAAGGGAAGG - Intronic
1086421034 11:86637492-86637514 AGCAGGGCTAAGAGAAGCAAGGG + Intronic
1088013942 11:105036863-105036885 CTTAGGGCTTAGAGAAAGATAGG + Intergenic
1088648344 11:111936181-111936203 ATTAGGGCTCAGAGAAGGTCAGG - Intronic
1089092036 11:115886122-115886144 CTCAGGCCCCAGAGAATGAAGGG - Intergenic
1089353296 11:117833618-117833640 TCCAGGCCACAGAGAAGGAATGG - Intronic
1089362873 11:117902545-117902567 CTGAAGGCCCAGAGAAGGCAGGG + Intronic
1089623147 11:119734315-119734337 CTCCAGGCTCAGAGAAAGATGGG - Intergenic
1089764430 11:120752508-120752530 CTCTGGGCTCAGGGAAGGGGTGG - Intronic
1090185853 11:124738749-124738771 CTAAGGTCCCAGAGAAGGGAAGG - Intergenic
1090213415 11:124939241-124939263 CAGAGTGCTCAGAGAAGGCAGGG - Intergenic
1090672347 11:128957475-128957497 TGCAGGGCTCACAGAAGAAAAGG - Intergenic
1091101298 11:132876253-132876275 CTCAGTGCTCACAGAAGGAGGGG + Intronic
1202812679 11_KI270721v1_random:33984-34006 GTCAGGGCCCTGAGGAGGAAGGG + Intergenic
1202819786 11_KI270721v1_random:64120-64142 CTCAGAGTTCAGAGTTGGAAAGG + Intergenic
1091837871 12:3598467-3598489 CTCTGTGCTCAGGGAAGGACTGG + Intergenic
1091847958 12:3672023-3672045 CCCAAAGCTCAGAGAAGGGAAGG - Intronic
1092826381 12:12403708-12403730 CCCAGGGCTGAGGGAGGGAATGG - Intronic
1092829091 12:12426620-12426642 CTTAAGTCTCAGAGAAGTAAAGG - Intronic
1093125390 12:15322549-15322571 CCCCGGGCGCAGAGGAGGAAAGG + Exonic
1094331345 12:29297615-29297637 CTTGGGGCTCAGAGAGGGCAAGG - Intronic
1094703628 12:32894779-32894801 CTATGGGCACAGAGAATGAATGG + Intronic
1095324857 12:40877186-40877208 CTCTGGGCTCAGTGAAGGTCAGG + Intronic
1096133236 12:49177610-49177632 CTCAGGGCTCAGAAAAGCACAGG - Intergenic
1096215499 12:49795805-49795827 CCCTGGGCTCAGAGAAGAATGGG - Exonic
1096749703 12:53751214-53751236 CGCAGGGCTCAGAGGAGGGGCGG - Intergenic
1097281130 12:57846097-57846119 CTCGGGGCTGAGAGACGGAGGGG - Intronic
1097595155 12:61620419-61620441 CTTAGGTCTCAGATAAGGTATGG - Intergenic
1100462083 12:94809712-94809734 TTCAGGGGACAGAGAAGGGAGGG - Intergenic
1100956457 12:99914667-99914689 ATCAGGGCTCTGATAGGGAAAGG + Intronic
1101591858 12:106131897-106131919 CCCAGGCCTCAGAGTAGGAGGGG - Intronic
1101773197 12:107770685-107770707 CTCAAGGCTTGGAGAATGAATGG - Intergenic
1102041350 12:109802917-109802939 CTCAGGAGTCAGACAAGCAAAGG + Intronic
1102587033 12:113930721-113930743 CTCAAGGTTCAGGGAAAGAACGG - Intronic
1103582946 12:121929648-121929670 GCCAGGGCTCAGGGGAGGAAGGG - Intronic
1105634559 13:22204590-22204612 CAAATGACTCAGAGAAGGAAAGG + Intergenic
1105706661 13:22971578-22971600 CTCAGGGCTCTGAGGGGGACTGG - Intergenic
1106125208 13:26895518-26895540 CCCAGGGCTCAGGCGAGGAAGGG + Intergenic
1107389955 13:39953497-39953519 ATCAGGCCCCAGAGAAGCAAAGG + Intergenic
1107691530 13:42958164-42958186 ATGAGGAATCAGAGAAGGAAAGG + Intronic
1107970978 13:45641890-45641912 CTCAGGGCCCAGAACAGAAAGGG + Intergenic
1112651640 13:101405540-101405562 ATCTGGGCTCAGAGAAAGAGGGG - Intronic
1113037091 13:106062286-106062308 GGCAGGGCTGAAAGAAGGAAGGG - Intergenic
1113040838 13:106102254-106102276 CACAGGTCTCAGAGGAGGGAAGG + Intergenic
1113350578 13:109525299-109525321 CTCAGGGCTCAGCGGAGGATGGG - Intergenic
1113673686 13:112194150-112194172 CTCAGGGCGCAGAGGGGGACAGG - Intergenic
1113892197 13:113742368-113742390 TTCAGGGCTCCCAGCAGGAAAGG - Intergenic
1114618387 14:24080680-24080702 TTCAGGGCTCAGAGCAGCAAAGG - Exonic
1115426362 14:33264759-33264781 CTGATGGCTCAGAAAAGGAGAGG - Intronic
1117654577 14:57941520-57941542 TTTAGGGCTGAGGGAAGGAAAGG + Intronic
1117908011 14:60610607-60610629 ATAGGGGCCCAGAGAAGGAAAGG - Intergenic
1117947221 14:61041089-61041111 CTTAGAGCAGAGAGAAGGAAGGG + Intronic
1118894064 14:69931257-69931279 CTCATGGCTGAGACGAGGAAAGG - Intronic
1121134536 14:91484186-91484208 TTCATGTTTCAGAGAAGGAAAGG + Intronic
1121426350 14:93854859-93854881 CACTGGGCTCAGGGAAGGAATGG + Intergenic
1121493608 14:94377469-94377491 GTCGGGACTCAGAGGAGGAAAGG + Exonic
1121530666 14:94650422-94650444 CTCAGGGCTCAGAAGAGGTGTGG - Intergenic
1122069585 14:99196933-99196955 CTCAGGGCTGGAAGGAGGAAAGG + Intronic
1122142400 14:99670637-99670659 CTCAGGGAAATGAGAAGGAAGGG - Intronic
1122907963 14:104810976-104810998 CACAGGTCACAGAAAAGGAAGGG + Intergenic
1125931183 15:43601139-43601161 CTGAGGACTCAGAAAAGAAAAGG + Intronic
1125944342 15:43700957-43700979 CTGAGGACTCAGAAAAGAAAAGG + Intergenic
1127815079 15:62601065-62601087 CACAAGGGTCAGAGAAGGTATGG - Intronic
1129378765 15:75152473-75152495 TACAGGGGTCAGAAAAGGAAGGG + Intergenic
1131083455 15:89555919-89555941 CTCAGGGCTCAGAGGCTGCAGGG + Intergenic
1131434942 15:92414980-92415002 CCCAGGGCTCTGGGGAGGAAAGG - Intronic
1131531767 15:93199857-93199879 CTGAGGACCCAGAGAAGGAAAGG - Intergenic
1132672293 16:1106779-1106801 GTCAGGGCTGGGAGAAGGCATGG - Intergenic
1132942525 16:2515049-2515071 TTCAGGCCTCAGGGAGGGAAAGG - Intronic
1133267134 16:4591987-4592009 ACCAAGGCTCAGAGAGGGAAGGG + Intronic
1134038575 16:11050718-11050740 CACTGAGCTCAGAGGAGGAAAGG - Intronic
1134277066 16:12786129-12786151 CTCATGGCACAGAGATGGCAGGG + Intronic
1134827143 16:17293949-17293971 CTCTGGGGTCAGAGAAGAATGGG + Intronic
1135264857 16:21015385-21015407 CTTGGGGATCAGGGAAGGAAGGG + Intronic
1136137271 16:28264186-28264208 CTGATGGGTCAGAGGAGGAAGGG + Intergenic
1136500790 16:30668910-30668932 CTCCAGGCTCAGACAAGGAGCGG + Exonic
1136567501 16:31079053-31079075 CTGAGGGCTCAGAGGAGGAGGGG + Exonic
1137393940 16:48103835-48103857 CTCAAAGCTCAGAGCAGCAACGG + Intronic
1137557953 16:49484559-49484581 ATCAGGGCTCAGGGGAGGGAAGG + Intergenic
1138481622 16:57307140-57307162 CTCTGGGCTCTGCGAAGGCAGGG + Intergenic
1139156895 16:64454338-64454360 CTCAGAGAGCAGAAAAGGAAAGG + Intergenic
1139545351 16:67647285-67647307 CTCAAGGCTCTGAGAAGCAGAGG - Exonic
1141284746 16:82661040-82661062 GTCAGGTCTCCGTGAAGGAAAGG + Intronic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142608725 17:1096483-1096505 CTCAGGGAGGAGAGGAGGAAGGG + Intronic
1143024829 17:3935378-3935400 CACAGGGCTGAGAGAGGAAAAGG - Intronic
1143266561 17:5642408-5642430 CTCAGTACTCAGTGAATGAATGG - Intergenic
1144058013 17:11558904-11558926 CTCAGGGGTCAGCAAAGGAAGGG - Exonic
1145240470 17:21238091-21238113 CTCTGTGATCAGAGAAGGGAAGG - Intergenic
1146207802 17:30920131-30920153 CTAAGGTGTCAGAGAAGCAAAGG + Intronic
1146377427 17:32303987-32304009 CCCAGGGCTCAGAGGATGAGAGG - Intronic
1146929678 17:36768405-36768427 CTCAGGGTTCAGGGAAGCCACGG + Intergenic
1147176517 17:38659240-38659262 CTCAGGGTCCAGAGGAGGAAGGG + Intergenic
1148344451 17:46894309-46894331 CCCAAGGCCCAGAGAAGGAAAGG - Intergenic
1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG + Intronic
1148830550 17:50428031-50428053 CTCAGGGCTCAGGCCAGGCAAGG + Intronic
1148846361 17:50532452-50532474 CTCCCGGCCCAGAGGAGGAAGGG + Intergenic
1148966665 17:51441508-51441530 CCCAGGGCCCAGAGGAGGAAGGG + Intergenic
1149144916 17:53478796-53478818 CTCAGGGCACAGAGCAGGGTGGG + Intergenic
1149314125 17:55422426-55422448 CTCAAGGGTCAGACAAGGACAGG - Intergenic
1149323849 17:55509732-55509754 CTCTGAGCTCAGGGAAGGGAGGG + Intergenic
1149453665 17:56770111-56770133 ATCAGGGGTCAGACCAGGAAAGG - Intergenic
1149598846 17:57880467-57880489 CTCAGGGCGGAGAGTAGCAAGGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151362594 17:73597535-73597557 CTCAGGGCTCATGGAACGACAGG + Intronic
1151989364 17:77564400-77564422 CTCTAGGCTCAGAGAAGGGAGGG - Intergenic
1152409744 17:80117430-80117452 CTCAGGGCTCACTGTAGGTAGGG - Intergenic
1152699508 17:81812072-81812094 TTCGGGTCTCAGAAAAGGAAGGG - Intronic
1152800721 17:82329557-82329579 CTGAGGGGTCACAGCAGGAAAGG - Intronic
1153659847 18:7316983-7317005 CCCAGAGCTCAGAGCAGGATGGG - Intergenic
1156111973 18:33739239-33739261 CTCTGGGCTCTCAGAAGAAAAGG - Exonic
1157225830 18:45863599-45863621 CTCAGGGCTCAATGAAAGTATGG + Intronic
1157274929 18:46303774-46303796 CCCAGGGCACAGAGAAGCCAGGG + Intergenic
1157938375 18:51898084-51898106 TTAAGGGCTCAGAGACAGAAGGG + Intergenic
1158117841 18:54016390-54016412 TTCAGGTCTCAGTGCAGGAATGG - Intergenic
1158733857 18:60057298-60057320 CTCAGGACTCTGAGAAAGCAAGG + Intergenic
1159201551 18:65192124-65192146 ATCAGGGTTCAGAGAATCAAAGG + Intergenic
1160855134 19:1213853-1213875 CCCACGGCTCAGAGCAGGACTGG - Intronic
1161355891 19:3819438-3819460 CTCGGGTCTGAGTGAAGGAATGG + Intronic
1162057128 19:8071489-8071511 CCCAAGGCTCAGACAGGGAAGGG + Intronic
1162953140 19:14083682-14083704 CTCAGAGCTGCGAGAAGAAAGGG + Intronic
1163035227 19:14565857-14565879 GTGAGCGCTCAGAGCAGGAAGGG - Exonic
1163438527 19:17309847-17309869 GTCAGGGGTCGGAGAAGGAGTGG - Intronic
1164649028 19:29878953-29878975 GTTAGGGCTCAGAGATGGAGGGG - Intergenic
1164729295 19:30490435-30490457 CACAGGGGTCTGAGGAGGAAAGG + Intronic
1164860068 19:31555699-31555721 CTCAGGGGTTACAGAAGGAAAGG + Intergenic
1165094284 19:33402103-33402125 CTCAGGGCTCAGCCCAGGCAGGG + Intronic
1166042289 19:40211259-40211281 CTCAGGGGTCAGATCAGGCAGGG + Intronic
1166140375 19:40802198-40802220 CCCTGGGCTGAGGGAAGGAAAGG + Intronic
1166213999 19:41323992-41324014 CTCATGCCTCTGAGATGGAATGG + Exonic
1166271924 19:41719752-41719774 CTGAGGGCTCAGAGACTGTAAGG - Intronic
1166496688 19:43307973-43307995 CTCAGGGCTGAGAAAAAAAAAGG - Intergenic
1166881451 19:45932916-45932938 CTGAAGGCTCAGAGGAGCAAAGG + Intergenic
1167684372 19:50946913-50946935 CCCAGGGCACAGAGAAGAAATGG + Intronic
1167708608 19:51097035-51097057 CACAGGGGTCAGGGAAGGAAGGG - Intergenic
1168636336 19:58000037-58000059 ATTAGGGCTCAGAGAAGGTTAGG + Intronic
925404503 2:3597157-3597179 CTCCGGGGTCAGTGAATGAATGG + Intronic
925404515 2:3597212-3597234 CTCCGGGGTCAGTGAATGAATGG + Intronic
925533712 2:4893030-4893052 CTCTGAACTCAGGGAAGGAAGGG + Intergenic
925576725 2:5367988-5368010 TTAAGAGCTCAGAGAAGTAATGG + Intergenic
926107644 2:10162482-10162504 TTCTGGGGACAGAGAAGGAAGGG - Intronic
926638959 2:15214736-15214758 CTCTGAGCTCTGAGAGGGAAGGG + Intronic
927847472 2:26479091-26479113 CCCAGGGCACAGACAAGGACAGG - Intronic
928399926 2:30970554-30970576 CTCATGGTTTAGAAAAGGAAAGG + Intronic
928645164 2:33344518-33344540 TCCAGGGCTCAGGGAAGGAGAGG - Intronic
928875701 2:36036545-36036567 TTCGTGGGTCAGAGAAGGAAGGG + Intergenic
928948341 2:36792018-36792040 CTCAGACTTCAGAGCAGGAAGGG + Intronic
929335492 2:40739223-40739245 CTCACTGCCCAGGGAAGGAAAGG - Intergenic
929564098 2:42974111-42974133 GACAGGGCTCAGAGAGGGAGAGG + Intergenic
929599719 2:43197619-43197641 CTAAGGGCACTGAGAAGTAACGG + Intergenic
929802999 2:45120346-45120368 ATGAGGGCCCAGAGAAGCAAAGG + Intergenic
929829995 2:45339437-45339459 CTCCGTGCTCACAGAGGGAAAGG - Intergenic
930020819 2:47001175-47001197 CTCCAGTCTAAGAGAAGGAAAGG - Intronic
933157369 2:78991228-78991250 CTCAGCCCTGAGAGGAGGAAAGG - Intergenic
933444757 2:82365440-82365462 CAAAGGGCACAGAGAAAGAAAGG - Intergenic
934035899 2:88088301-88088323 CCCTGGGCTCAGAAATGGAAGGG - Intronic
934992670 2:98932645-98932667 GTCAGGGCTGGGAGAAGGCAAGG - Intronic
935245996 2:101219264-101219286 CTCTGGGCCCAGAGAAACAAAGG - Intronic
935674118 2:105579754-105579776 AGCAGGGGTCAGAGAAAGAAGGG - Intergenic
935865752 2:107385892-107385914 CTCAGGGCTCAGCAAATGAGTGG - Intergenic
936151606 2:110025018-110025040 CTCAGGGATGAGGGAAGGGATGG + Intergenic
936193068 2:110346351-110346373 CTCAGGGATGAGGGAAGGGATGG - Intergenic
937085473 2:119169005-119169027 CTCTGGAGGCAGAGAAGGAAGGG + Intergenic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
940205875 2:151201288-151201310 CTCAGGACTTGGAGCAGGAACGG - Intergenic
940858108 2:158745501-158745523 TTCAGTGCTCGGAGAAGAAAAGG - Intergenic
941133325 2:161681894-161681916 CTCAAGGCAGAGAGAAGGATAGG - Intronic
941348887 2:164406685-164406707 CACAGGGCTCCAAGATGGAATGG + Intergenic
941466132 2:165829483-165829505 CTTAAGGCTCTGAGAAGGTAAGG + Intergenic
942693525 2:178612863-178612885 CCCAGGGCTCATGGAAGGACAGG - Exonic
945057250 2:205879817-205879839 CTCGGGGCTTAGAGCAGAAATGG - Intergenic
945979397 2:216296896-216296918 CTCTGGGCTCAGAGCACCAAAGG + Intronic
946309838 2:218877408-218877430 CTCTGGGCTCAAAGAAGATAAGG - Intergenic
946397786 2:219451883-219451905 CTCAAGGCTGAGAGTGGGAAGGG - Intronic
946554302 2:220837419-220837441 CCCAGGGCAGAGAGGAGGAAGGG - Intergenic
946617777 2:221528042-221528064 CTGTGTGCACAGAGAAGGAAGGG - Intronic
946852723 2:223922709-223922731 CTCAGTGCTCATGGAAAGAAGGG + Intronic
947025564 2:225734084-225734106 CTCAGGGATCAAAGAACAAATGG - Intergenic
948364818 2:237448090-237448112 CTCAGGACTCATGGAATGAATGG - Intergenic
948491385 2:238315332-238315354 CTCAGAGCTCAGAGACGGATGGG + Intergenic
1168834467 20:868912-868934 ATTAGGGCTCAGAGAGGGAAAGG - Intergenic
1169199884 20:3703756-3703778 CTCAGGCCTCAGGGACGGAGGGG - Intronic
1169297467 20:4412492-4412514 CTCAGTGCTTAGAGATGGTATGG - Intergenic
1169393075 20:5205915-5205937 CTAGGGGCACAGAGAGGGAAGGG + Intergenic
1169456652 20:5758289-5758311 TTAATGTCTCAGAGAAGGAAAGG + Intronic
1170799688 20:19580886-19580908 CTCAGGGGAGAGAGAAGGAAAGG - Intronic
1170896643 20:20420842-20420864 GTCTGAGCTCAGAGAAGGAATGG + Intronic
1171517347 20:25747910-25747932 CTCAGGGCTCAGTGAAGTTTGGG + Intergenic
1172167659 20:32908732-32908754 CTCATGACTGAGACAAGGAACGG - Intronic
1173689353 20:44948076-44948098 ATTGAGGCTCAGAGAAGGAAGGG - Intronic
1174419926 20:50392793-50392815 CTCAGGAGGCAGAGATGGAAAGG + Intergenic
1174825668 20:53766203-53766225 CACAAGGCTTAGAGAAGTAAAGG + Intergenic
1175891951 20:62319640-62319662 CTCAGGGCTCAGAGCCAGGAGGG - Intronic
1176386554 21:6140998-6141020 TTCAGGGCCCACAGAGGGAAGGG - Intergenic
1177255430 21:18655736-18655758 CTCAGGACACAGAGGAGGCAGGG - Intergenic
1177335707 21:19723384-19723406 CTGAGGGCTAGGAGAAAGAAAGG + Intergenic
1179073962 21:38100540-38100562 CTTAGCTGTCAGAGAAGGAAGGG + Intronic
1179111747 21:38452790-38452812 CTCAGGGCTCTGAGAAGGCCTGG + Intronic
1179378677 21:40878415-40878437 CTTAGGGCACAGAGACGGCAGGG - Intergenic
1179397938 21:41058423-41058445 CTCAGGCTTCAGAGTAGGATAGG - Intergenic
1179524377 21:41966103-41966125 CTCAGGGCTCTGAGAGGACATGG + Intergenic
1179670395 21:42942890-42942912 CACAGGGCTCAGGGAAGGCCCGG + Intergenic
1179681017 21:43021516-43021538 CTCTGGGCTCAGAAAATCAAAGG + Intronic
1179736919 21:43397254-43397276 TTCAGGGCCCACAGAGGGAAGGG + Intergenic
1179878864 21:44285259-44285281 ACCGAGGCTCAGAGAAGGAAAGG + Intergenic
1180138775 21:45878227-45878249 CTGTGGTCTCAGAGAATGAAGGG + Intronic
1181440979 22:22935091-22935113 CCCAAGGCACAGGGAAGGAATGG - Intergenic
1181473017 22:23152373-23152395 CAGAGAGCTCAGGGAAGGAAGGG + Intronic
1181673176 22:24435504-24435526 CTCAGAAAACAGAGAAGGAAAGG - Intronic
1181876452 22:25944386-25944408 TTCGGGGCTCAGAGAGGGATGGG - Intronic
1181957655 22:26599806-26599828 CCCAGGGCACAGAGCAGGAAGGG - Intronic
1181957867 22:26601325-26601347 CTGAGCGTTCAGAGCAGGAAGGG + Intronic
1182003573 22:26940716-26940738 CACAGGGGCCAGAGAAAGAAGGG - Intergenic
1182282544 22:29225731-29225753 GACACGGCTCAGAGCAGGAAGGG - Intronic
1182520641 22:30882672-30882694 CTCAGGGCCCTGGGAAGGAACGG + Intronic
1182736210 22:32533522-32533544 CACAGGCCTAAGGGAAGGAAAGG - Intronic
1183985451 22:41567612-41567634 GGCAGGGCCCAGAGAGGGAAAGG + Intronic
1184054329 22:42034154-42034176 CTCTGAGATCAGAGAAGGCAGGG + Intronic
1184271294 22:43385772-43385794 AGCAAGGCTCAGAGGAGGAAGGG - Intergenic
1184354212 22:43967782-43967804 CTGAGGACACAGAGAAGGAAAGG - Intronic
1184405555 22:44298662-44298684 CACAGGACTCAGGGAGGGAAGGG + Intronic
1184445812 22:44546169-44546191 CTCAACGCTCAGAGAAGTGAGGG - Intergenic
1184716048 22:46282372-46282394 CAGAGGCCTCAGGGAAGGAAAGG + Intronic
1185035043 22:48470326-48470348 CACGGGGCTCACTGAAGGAAAGG - Intergenic
1185070325 22:48652510-48652532 GTCAGGGCTCAACGCAGGAAGGG - Intronic
949591081 3:5495004-5495026 GTCAGGGCTCAAAAAAGGAGTGG - Intergenic
949917487 3:8975916-8975938 CTCAGGCCTAAGAGAGAGAATGG + Intergenic
950329821 3:12147417-12147439 CTCAGGCCACGCAGAAGGAAAGG - Intronic
950424566 3:12918124-12918146 ATCAGGGCTCAGAGAAGGAAGGG - Intronic
950545697 3:13636741-13636763 TTCAGGGTTGAGAGAAGGAAGGG + Intronic
952529231 3:34246123-34246145 CTGAGAGCTGAGAGAAGGGAGGG + Intergenic
952887716 3:38021822-38021844 ATCTGGGCTCAGAAAAGAAAAGG - Intronic
953357879 3:42269754-42269776 CTCTTGTCTCAGAAAAGGAATGG + Intergenic
953899125 3:46829196-46829218 CTCAAGGCTTGGAGAAGGAGGGG + Intergenic
954440169 3:50517417-50517439 CTCCTGCCTCAGAGAGGGAAGGG - Intergenic
954693031 3:52405925-52405947 TCCAGGGCTCAGAGGAGAAAGGG + Intronic
956093738 3:65694551-65694573 CTCAGGGGTCAGAGAACAAAAGG + Intronic
956749470 3:72334662-72334684 AGCAGGGCTCAGAGAAGTTAAGG + Intergenic
956915418 3:73865976-73865998 CAGAGGGCTCTGAGAAGGAAGGG + Intergenic
959024952 3:101230563-101230585 TTCAAGGCTCATCGAAGGAAAGG - Intronic
959145208 3:102535687-102535709 CTCAGAGCTCAGAGAGAGTAGGG - Intergenic
960699595 3:120427251-120427273 ATCAAAGTTCAGAGAAGGAAGGG - Intronic
961106579 3:124248066-124248088 CTCAGATCTCATAGAAGGGATGG - Intronic
961450232 3:126999348-126999370 CCCAGGGCTGGGAGAAGGACAGG - Intronic
961736100 3:129003034-129003056 CGCAGGGGTCAGAGGAGGAAAGG + Intronic
962503264 3:136017876-136017898 CTAAGGCCTTAGAGTAGGAAAGG - Intronic
962876931 3:139542270-139542292 CTCAGGGTGCTGAGAAGCAAAGG + Intergenic
964032174 3:152151515-152151537 TTCTGGGGTCGGAGAAGGAAAGG + Intergenic
967813580 3:193780852-193780874 CTCAGATCTCTGAGAATGAAGGG - Intergenic
968730403 4:2266918-2266940 CCCAGGCCTCAGGGAAGAAAGGG - Intergenic
969294377 4:6261134-6261156 CTCAGGGCTGAAAGAAGTGAGGG + Intergenic
969394329 4:6910439-6910461 GTCAGGGCTCCGAGATGAAAGGG - Intronic
970726131 4:19047026-19047048 CTCTGGGGTTAGAGAAGGCAAGG - Intergenic
970888456 4:21013942-21013964 GTGAAGGCTCAGAGAAGTAAAGG - Intronic
971580113 4:28326505-28326527 CTCAGGGTTAAGTGAAGGACTGG - Intergenic
973595499 4:52484594-52484616 CTCAGAGCTAAGAGATGGCAAGG - Intergenic
973696725 4:53497550-53497572 CTCTGGGCCCAGAGAAGGTCAGG + Intronic
975711081 4:77160018-77160040 CTCAGGGCACTGAAAAGAAAAGG + Intronic
976602319 4:86949658-86949680 GTGAGCGCTCAGAGCAGGAAGGG + Intronic
978138377 4:105290143-105290165 CTTAGGTCTCAGAAAAGGTATGG + Intergenic
979189010 4:117834247-117834269 CTCAGGGATAAGAGGTGGAAGGG - Intergenic
979765763 4:124462855-124462877 GTGAGTGCTCAGAGCAGGAAGGG + Intergenic
983323552 4:166225807-166225829 TTCAGGGCTCAAAAGAGGAAAGG - Intergenic
985295292 4:188431407-188431429 CCCAGGGCTGAGAGAGGGAATGG + Intergenic
985509904 5:307552-307574 CTCAGGGCTGAGAGGAAGCAGGG + Intronic
985912886 5:2897057-2897079 GTCTGAGCCCAGAGAAGGAAGGG - Intergenic
986253433 5:6081958-6081980 CACAGGGCTCAGGCAGGGAATGG + Intergenic
986438398 5:7757731-7757753 GTCAGGGCTCACAGCAGGCAGGG + Intronic
987380330 5:17279130-17279152 CTCAGGGTTGAGACCAGGAAGGG - Intergenic
988366407 5:30305912-30305934 CTCAGGGCTCAGACTTGGACTGG + Intergenic
989643710 5:43606668-43606690 TTTAGAGCTCAGAAAAGGAAGGG - Intronic
990613707 5:57485686-57485708 GTCAGGGCAAAGAGAAGGAGAGG + Intergenic
991113007 5:62923081-62923103 TTGAGGGCTCAAAGAAAGAATGG + Intergenic
991165795 5:63564590-63564612 ACCAGGACTCAGGGAAGGAAAGG + Intergenic
991169345 5:63603149-63603171 CTCATTATTCAGAGAAGGAAAGG + Intergenic
991654868 5:68893962-68893984 CTCAGGACTCAGAGACCCAATGG - Intergenic
992098999 5:73388382-73388404 CCGAGGGCTAAGAGAAGGGAAGG + Intergenic
992484013 5:77178767-77178789 CTCAAGGCTCAGTTAGGGAAGGG + Intergenic
992509632 5:77420204-77420226 CTCAGTGAACAGAGAAGTAAAGG - Intronic
993021592 5:82597922-82597944 CCCAGGGCTCAGAGAAGGACTGG - Intergenic
993572706 5:89561583-89561605 CTCTGGGATGAGAGAAGGTAAGG - Intergenic
993873348 5:93277469-93277491 CTCAGGGACCCCAGAAGGAAAGG - Intergenic
995337297 5:111014314-111014336 ATAAGGAATCAGAGAAGGAAAGG + Intergenic
995905950 5:117123282-117123304 CTGAGCTCCCAGAGAAGGAAAGG - Intergenic
996223516 5:120961360-120961382 CTCAGGGCTCACAGAAATGAGGG + Intergenic
996754291 5:126919891-126919913 ATCAGGTCTCAGACAAGGACTGG - Intronic
997243031 5:132322041-132322063 CTCATGGCCCAGAGCAGGCATGG - Intronic
997475552 5:134140388-134140410 CTCAGGGATTTGAGGAGGAAGGG + Intronic
998855772 5:146393898-146393920 CTCAGAGCTTAGAGAAGAGAAGG - Intergenic
999086932 5:148900955-148900977 CAGAGGTCTCAGAGAAGGCATGG + Intergenic
999505930 5:152196314-152196336 CTCAGGCATCAGACAAGGGAAGG - Intergenic
1001229771 5:169976264-169976286 CACAGGGCTTAGAGTCGGAAAGG + Intronic
1001734484 5:173987956-173987978 ATGGAGGCTCAGAGAAGGAAAGG + Intronic
1001932976 5:175686289-175686311 CCCAGGGCTCAAACAAGTAACGG - Intergenic
1002787060 6:410082-410104 CTCAGGACTCTGAAAAGGAACGG + Exonic
1002966367 6:1970479-1970501 CTCAGTGGGCAGGGAAGGAATGG + Intronic
1003245041 6:4376248-4376270 CTCAGAGCCCACAAAAGGAAAGG - Intergenic
1004435564 6:15589699-15589721 CTAAGACCTTAGAGAAGGAAAGG - Intronic
1004930038 6:20454120-20454142 CTTAGGGCTCATAAAAGGCATGG - Intronic
1005771548 6:29077846-29077868 CTCAGGTCTGAGAGAAGCCAAGG + Intergenic
1005959202 6:30684233-30684255 AGGAGGGCTCTGAGAAGGAAGGG + Intronic
1006146523 6:31962964-31962986 CGCTGGGCACAGAGAGGGAAGGG - Exonic
1006192771 6:32219813-32219835 CACAGGGGTCAGGGCAGGAAGGG + Intronic
1006297342 6:33175728-33175750 CTCTGGGCCCAGAGGAGAAATGG + Intronic
1006455519 6:34129786-34129808 CACAAGGCTCAGAGCTGGAAGGG - Intronic
1006770509 6:36548704-36548726 CTCTGGGCAGAGAGAATGAAAGG - Intergenic
1006781316 6:36634306-36634328 CTCATGGCTAAGAGAAACAACGG - Intergenic
1007263188 6:40577992-40578014 CTCAGGGGGCACAGAAGGGACGG - Intronic
1007313071 6:40962045-40962067 ACCAAGGCTCAGAGAAAGAAGGG - Intergenic
1007376496 6:41460322-41460344 CCCAGGGCTCTGAGGAGGACAGG + Intergenic
1007833562 6:44656784-44656806 TACATGGCTAAGAGAAGGAAGGG + Intergenic
1007839167 6:44701555-44701577 CTCAGGGCTAAGTGAAGCATGGG + Intergenic
1008857886 6:56113287-56113309 CTCAAGGATTATAGAAGGAAGGG - Intronic
1009725444 6:67531477-67531499 CTCAGGGCTAAAAGATGAAAGGG - Intergenic
1010379627 6:75209255-75209277 CTCAGGGCTGAGAGGCGGCAGGG + Intergenic
1011026994 6:82880275-82880297 CTCCTGGTTCAGAGAAGAAAGGG + Intergenic
1012623715 6:101380118-101380140 TCCAGGGCTCAGGGAAGGATTGG - Intergenic
1013095742 6:106943489-106943511 CGCAGGGCTGAGAAAAGAAAAGG + Intergenic
1013368307 6:109450647-109450669 CCTGGGGCCCAGAGAAGGAAGGG + Intronic
1013648615 6:112170717-112170739 CTCAGGGCTCCAAAAAGTAAGGG - Intronic
1014754908 6:125292147-125292169 CTTAGGGCTCAAGCAAGGAAGGG + Intronic
1017094099 6:150789049-150789071 CTCAGGAATCAGAGAGGGAGAGG + Intronic
1018009129 6:159653464-159653486 CCCAGGGCTCTGAGGAGAAATGG + Intergenic
1018973476 6:168545621-168545643 ATCAGGGCTGGGAGGAGGAACGG + Intronic
1019228871 6:170540376-170540398 TTTAGGCCTCAGAGGAGGAAGGG - Intronic
1019266068 7:118081-118103 CCCAGGGCTCAGCCAAGAAATGG + Intergenic
1020006334 7:4785402-4785424 CTCAGGGCTCCTGGAAGGAGGGG - Exonic
1020631008 7:10639768-10639790 CTTAGACTTCAGAGAAGGAAGGG + Intergenic
1020810825 7:12847764-12847786 CAGAGGGCTCAGAAAAAGAAAGG - Intergenic
1021669752 7:23023472-23023494 GCCAGGGCTTAGAGATGGAAGGG + Intergenic
1022010866 7:26307210-26307232 CTTGGGGCTGAGATAAGGAAAGG - Intronic
1022304751 7:29136641-29136663 CTCAGAGATAAGAGAAGGATGGG + Intronic
1022525201 7:31032684-31032706 CTCAGGACTCACAGATGGAGTGG + Intergenic
1023788629 7:43734143-43734165 CTCATGGGTCAAAGAAGTAATGG + Intergenic
1024022730 7:45386532-45386554 ATCAGGGCTCAGAGTAGGTGGGG - Intergenic
1024478633 7:49840841-49840863 CTCGGGGGTCAGAGAAAGGATGG - Intronic
1024504091 7:50146711-50146733 CAGAGGGCTGAGAGAAGGGAAGG - Intronic
1025142891 7:56480008-56480030 CTCAGGGCTCAGGGAAGTTTGGG + Intergenic
1025258542 7:57401022-57401044 CTCAGGGCTCAGTGAAGTTTGGG + Intergenic
1026576828 7:71578875-71578897 CAGAGGTCTCAGAGAAGGCAGGG - Intronic
1026996939 7:74623444-74623466 CTCAAGGCTCAGCTAAGGATAGG - Intergenic
1027221392 7:76216485-76216507 ATCAAGGCTCAGAGAAGGAAGGG - Intronic
1029105307 7:98170253-98170275 CTCAGGGCTCAAAGCACAAATGG + Intronic
1029784401 7:102772936-102772958 CCCAGGGCTCAGAGAAGGTGAGG - Intronic
1029805710 7:102994009-102994031 CTCAGGGACTTGAGAAGGAAAGG - Intronic
1030020043 7:105264691-105264713 CTCAGGGAACAGATACGGAAAGG - Intronic
1031269019 7:119621151-119621173 CTTAGGACTCATGGAAGGAAGGG + Intergenic
1031578612 7:123444950-123444972 CCCATAGCTCAGAGAAGAAAGGG - Intergenic
1031867862 7:127059098-127059120 CTGAGGACTCAGAAAAGGAAAGG + Intronic
1032005658 7:128300307-128300329 CTGAGGGCTCTGAGCAGGGAAGG + Exonic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032490394 7:132319951-132319973 CTCAGGTGTCTGAGAAGGCAGGG - Intronic
1033039544 7:137905558-137905580 CCCAGGGCTTAGGGAAGGGAAGG + Intronic
1033249629 7:139747536-139747558 CTTTGGGATCAGAGAAGGAACGG + Intronic
1034087912 7:148337213-148337235 CTCAGGGAGCAGAGAGGGAGGGG - Intronic
1034531572 7:151699127-151699149 GACAGAGGTCAGAGAAGGAAAGG - Intronic
1035040147 7:155921169-155921191 CCCTGGGCTCAGAGCAGGGAGGG + Intergenic
1035670394 8:1412557-1412579 CTGAGGGCTCACAGCTGGAATGG - Intergenic
1035725890 8:1824493-1824515 CTCAGGATGCAGAGAAGGACCGG + Intronic
1035756002 8:2033613-2033635 CTCAGGGCTCAGCGCAGGTCAGG - Intergenic
1035917928 8:3645172-3645194 CCCAGGACTCAGTGAAGTAAGGG - Intronic
1036476054 8:9094529-9094551 CACAGGACACAGAGAAGGAGAGG - Intronic
1036805379 8:11828423-11828445 CACAGGGCTCAGAGAAGGGAAGG + Intronic
1036960678 8:13241592-13241614 TGCAGGGTGCAGAGAAGGAAAGG - Intronic
1037062992 8:14539403-14539425 CTCAGGGGTCAGGGAAGGCTAGG + Intronic
1037712290 8:21364493-21364515 CACAGGGCTCATTCAAGGAAAGG + Intergenic
1037729936 8:21515906-21515928 GTTAGGGGTCAGAAAAGGAAAGG - Intergenic
1037814325 8:22103783-22103805 CTCAGGGGACAGATAAGGGAAGG + Exonic
1040386008 8:46915576-46915598 CGCAGGGCTCAGGACAGGAAGGG + Intergenic
1040867225 8:52060267-52060289 TGCAGGTCTCAGAGAAGGGATGG - Intergenic
1041350599 8:56944429-56944451 TTCAGGGCTGAGAAAATGAAAGG + Intergenic
1041526151 8:58808462-58808484 CTCATGGCTAAATGAAGGAAAGG - Intronic
1042696127 8:71556804-71556826 CACAGCGCTCCGAGAAGGAGCGG + Intronic
1042719592 8:71813025-71813047 AGCATGGCTTAGAGAAGGAAAGG - Intergenic
1043158652 8:76818266-76818288 CTTAGGGTTAAGAGGAGGAATGG + Intronic
1043416790 8:80059416-80059438 CCCAAAGCTAAGAGAAGGAAGGG + Intronic
1044499718 8:92939603-92939625 CACAGATCTCAGAGAAGCAAAGG + Intronic
1044534759 8:93345857-93345879 CTTAGGGCTCCAAGATGGAAAGG + Intergenic
1044534809 8:93346181-93346203 CTGAGGGCTCCAAGATGGAAAGG + Intergenic
1044933733 8:97274787-97274809 CTCAGGGATAAGAGAGGGAAAGG + Exonic
1045005124 8:97910784-97910806 CTGAAGGCTCAGAGAAGTTAGGG - Intronic
1045498109 8:102725492-102725514 GTCAGGAGACAGAGAAGGAAAGG + Intergenic
1046330005 8:112701810-112701832 CTCAGGGCACAGAGGTTGAAAGG - Intronic
1047492853 8:125388679-125388701 CTCAGGGCTCGGGGAAGGGGTGG - Intergenic
1048006741 8:130425673-130425695 CTTAGGGATCAGAGAATGACAGG + Intronic
1048195023 8:132325347-132325369 ATCAAGGCTCAGAAATGGAAAGG - Intronic
1048439754 8:134451131-134451153 GTCAGTGCTCAGTGAATGAATGG + Intergenic
1048888376 8:138926689-138926711 CCCAGGAATCATAGAAGGAAGGG - Intergenic
1049069442 8:140345430-140345452 CTCAGGGCCCAGAGATGGGACGG - Intronic
1049205168 8:141360319-141360341 GTCAGGGCTCAGAGTGGGACAGG - Intronic
1049306971 8:141909167-141909189 CACAGGCCTCAGAGACAGAAGGG - Intergenic
1049919144 9:347010-347032 CTCAGTGCTAGGTGAAGGAAGGG + Intronic
1050189349 9:3008644-3008666 TTCAGAACTCAAAGAAGGAAAGG + Intergenic
1050745901 9:8875832-8875854 AGCAGGGCTCAGAGAAGTTAAGG - Intronic
1051094410 9:13449509-13449531 TCCAGGGCTTAGAGAAGAAAGGG - Intergenic
1052578441 9:30320597-30320619 CGAAGGCCTCTGAGAAGGAAGGG + Intergenic
1053043281 9:34892610-34892632 CTCTGGGTTCAGGGAAAGAAAGG + Intergenic
1053273726 9:36767675-36767697 TTCAGGACTGAGAGAAGGAGTGG + Intergenic
1053307853 9:36996543-36996565 CTCAGAGCTCCCAGAAGGGATGG - Intronic
1054928825 9:70615566-70615588 CTCAGCACACAGAGAAGGAAAGG - Intronic
1054959120 9:70947628-70947650 CTCAGAGCTCAGAGAAGGTGGGG + Intronic
1055079256 9:72251796-72251818 CTCAGGTCTGTGGGAAGGAAAGG - Exonic
1055333592 9:75208990-75209012 CACAGGGGTCACAGAAGCAAGGG - Intergenic
1057221408 9:93259662-93259684 CTCAGGACCCAGAGATGCAAAGG + Intronic
1057756894 9:97846400-97846422 GCCAGGGCTCAGGGAAGGCAGGG + Intergenic
1057900148 9:98942432-98942454 GTGAGGGCTCAGAGGAGGGATGG - Intergenic
1058850818 9:109010872-109010894 CTAAAAGCTCAGAGAAGGCATGG - Intronic
1059657502 9:116369659-116369681 CCCAGGGCCCACAGAGGGAAGGG - Intronic
1059948274 9:119435415-119435437 CTCAGGACACAGGGAAGCAAAGG - Intergenic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060089505 9:120730690-120730712 ACCAAGGCTCAGAGCAGGAAAGG + Intergenic
1060923110 9:127436528-127436550 CTCAGGGAAAACAGAAGGAAAGG + Intronic
1061088156 9:128411390-128411412 ATCAGGGCTGAGAGAGGGAAGGG + Intergenic
1061545126 9:131299913-131299935 CGCAGGGCCCAGGGAAGAAAGGG + Intronic
1062006787 9:134242468-134242490 ATCAGGGCTCAGAGAGAGAAAGG + Intergenic
1062610638 9:137371840-137371862 CTCAGGGCACCGAGAAGTCATGG + Intronic
1203583399 Un_KI270746v1:37244-37266 GGCAGGACTCAGAGTAGGAATGG + Intergenic
1187389799 X:18878495-18878517 CTCAGGCCTCAAAGAAAGATTGG - Intergenic
1187473588 X:19590214-19590236 CACAGGGGCCAGAGGAGGAAGGG + Intronic
1187616823 X:21004452-21004474 CTCATGTCTCAGCTAAGGAAGGG - Intergenic
1188440260 X:30209197-30209219 CCCAGGGCTCACAGTAGGACAGG - Intergenic
1189166269 X:38864119-38864141 CTGTGAGCTCATAGAAGGAAGGG + Intergenic
1189252818 X:39614266-39614288 CTCTGATCTCAGACAAGGAAAGG + Intergenic
1190379897 X:49829414-49829436 CCCTGGCCTCAGAGAAGGAAGGG + Intronic
1190427418 X:50346074-50346096 CCCAGAGGTCAGACAAGGAAGGG - Intronic
1190474047 X:50810578-50810600 GTCTGGGCTCAGAGTAGGAAAGG - Intronic
1192179466 X:68907331-68907353 ATGGGGGCTCAGAGAAGGCAAGG + Intergenic
1192208719 X:69113039-69113061 CTCAGGGTTCAGAGAAGCCAGGG + Intergenic
1195095745 X:101499534-101499556 GCCAGGGCTCAGAGTAGGAGAGG + Intronic
1195232708 X:102867271-102867293 TTCTGGGGTCAGAGAAGGAAAGG + Intergenic
1195575950 X:106450820-106450842 CTCAAAACTCAGAGAAGGGAAGG - Intergenic
1195800554 X:108704359-108704381 CGTAGGGCTGAGAGGAGGAAGGG - Intergenic
1196328087 X:114432889-114432911 CTATGAACTCAGAGAAGGAAAGG - Intergenic
1197151433 X:123224124-123224146 CACAGAAGTCAGAGAAGGAAAGG - Intronic
1197471721 X:126871328-126871350 CTCAGGGATCAGGGCAGGAGTGG - Intergenic
1197531467 X:127632991-127633013 TTGAGGGATCAGAGTAGGAATGG - Intergenic
1197979293 X:132198693-132198715 CAGGGAGCTCAGAGAAGGAAAGG - Intergenic
1198079184 X:133223078-133223100 CCCAGGGCTCAGCAAAGTAAAGG + Intergenic
1198175004 X:134146300-134146322 CTCTGGTCTCAGAGAATGAGAGG + Intergenic
1199470683 X:148192282-148192304 TTCAAGGTTCAGAGAAGAAAGGG - Intergenic
1199937707 X:152591807-152591829 CTCATGACTCAGAGAAGGAAAGG + Intergenic
1200063073 X:153492161-153492183 CTCAGGGCTGGGAGGAGGCAGGG - Intronic
1200116557 X:153772134-153772156 CTCAGGGCTCAGGGACGGAGGGG - Intronic
1200128286 X:153828505-153828527 CTTAGGGCGCAGAGCAGGGAGGG + Intronic
1200276408 X:154737246-154737268 GATAGGGCACAGAGAAGGAATGG - Intronic