ID: 1148770822

View in Genome Browser
Species Human (GRCh38)
Location 17:50064901-50064923
Sequence GGGAACTGCAAGGAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 1, 2: 8, 3: 92, 4: 660}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148770810_1148770822 24 Left 1148770810 17:50064854-50064876 CCTACACTGGGTGCTCAGCCTTC 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1148770822 17:50064901-50064923 GGGAACTGCAAGGAGGAGAAAGG 0: 1
1: 1
2: 8
3: 92
4: 660
1148770818_1148770822 -10 Left 1148770818 17:50064888-50064910 CCGAGGGAGCCGAGGGAACTGCA 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1148770822 17:50064901-50064923 GGGAACTGCAAGGAGGAGAAAGG 0: 1
1: 1
2: 8
3: 92
4: 660
1148770814_1148770822 6 Left 1148770814 17:50064872-50064894 CCTTCGTGGGAACAAGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1148770822 17:50064901-50064923 GGGAACTGCAAGGAGGAGAAAGG 0: 1
1: 1
2: 8
3: 92
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148770822 Original CRISPR GGGAACTGCAAGGAGGAGAA AGG Intronic
900864268 1:5255972-5255994 GGGAACTTCCAGGAGAAGAGTGG + Intergenic
901363810 1:8728070-8728092 AGGAACTGCCAGGAGCTGAAAGG - Intronic
901512517 1:9724570-9724592 GGGCACTGCAGGGTGGAGCAGGG - Intronic
902139401 1:14339980-14340002 GGGAACTTCAAGGTGAAGCATGG - Intergenic
902652078 1:17843663-17843685 GGGAAGTGAAAGGAGAAGGAAGG - Intergenic
902786879 1:18738589-18738611 GGGGAGTGACAGGAGGAGAAGGG - Intronic
903222467 1:21876401-21876423 TGCAACTGGGAGGAGGAGAAAGG + Exonic
904327626 1:29737802-29737824 GTGGACTGGAAAGAGGAGAAAGG - Intergenic
904422225 1:30401687-30401709 GGGAAGACAAAGGAGGAGAAAGG + Intergenic
904902004 1:33864963-33864985 GGGAAGGGAAAGGAGGGGAATGG + Intronic
904984370 1:34532867-34532889 GGAAAGGGCAATGAGGAGAAAGG + Intergenic
905224986 1:36473040-36473062 GAGAAATTAAAGGAGGAGAAGGG - Intronic
905812032 1:40919844-40919866 GGAAACAGCAGAGAGGAGAAGGG - Intergenic
905971693 1:42146631-42146653 GAGAACTACAAGGAGGACACGGG - Intergenic
906749698 1:48247952-48247974 GGGAAGAGGAAGGAGGATAAGGG - Exonic
906800228 1:48730561-48730583 GGGAAGTGGTAGAAGGAGAAAGG + Intronic
906821477 1:48934734-48934756 GGGAATAGAAAGGAGGGGAATGG - Intronic
907144945 1:52223271-52223293 GGGAACAGGGAGGGGGAGAAGGG - Intronic
907477475 1:54715294-54715316 GGGAACAGCAAGGAGGCCAGTGG - Intronic
908085691 1:60631106-60631128 TGGAACTGCAGGGAGGAAAAAGG - Intergenic
909573293 1:77142668-77142690 GAGAAGTGCAAGCAGGGGAAAGG + Intronic
909863566 1:80637662-80637684 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
910800436 1:91139483-91139505 GGAAACTTCAAGTAGGAAAACGG - Intergenic
911094387 1:94044016-94044038 GGGAACAGGAGGGAGGAAAAGGG - Intronic
911244170 1:95498595-95498617 CTGAACTGCAAAGAGGAGCATGG - Intergenic
912304836 1:108556932-108556954 GGGCACTGAAAGGTAGAGAATGG - Intergenic
912696198 1:111843960-111843982 GGGAATTGGAAGGTGGAGAAAGG - Intronic
912761089 1:112368135-112368157 GGAGAGTGCAAGGAGGAGCAAGG - Intergenic
913122926 1:115758348-115758370 GAGAAGAGGAAGGAGGAGAAGGG - Intronic
915304229 1:154968770-154968792 GGGGGCGACAAGGAGGAGAAAGG - Exonic
915672751 1:157504074-157504096 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
915766124 1:158364489-158364511 GGGAACTAAAAGCAGGAGAATGG + Intergenic
915871108 1:159560378-159560400 GGGAAGTGCAGGGAAGAGCATGG + Intergenic
916560641 1:165931686-165931708 AAAAACAGCAAGGAGGAGAAGGG - Intergenic
917371437 1:174298168-174298190 GGTATCTGCTAGGAAGAGAAGGG - Intronic
917561496 1:176161852-176161874 GGGATCTTCTAGTAGGAGAAAGG - Intronic
918619400 1:186584690-186584712 GTGAAAGGCAAGGAGGAGCAAGG - Intergenic
919032358 1:192259295-192259317 GAGAACAGCAGGTAGGAGAAAGG + Intergenic
920207067 1:204299906-204299928 GTGAACTCCAAGCAGTAGAAGGG - Intronic
920254327 1:204644240-204644262 GAGAGCTTCATGGAGGAGAAGGG - Intronic
921326370 1:213989131-213989153 GGGAACTGGGAGGAGGAGAGAGG + Intronic
921430292 1:215057700-215057722 GGGCAGTGCAGGAAGGAGAAGGG + Intronic
921696161 1:218213919-218213941 GGGAAGTGCTGGGAGGAGAAGGG + Intergenic
921761685 1:218922587-218922609 TGGAACTTCAGAGAGGAGAAAGG + Intergenic
921818327 1:219588959-219588981 GGGGACTGTGAGGAGGAGAAGGG - Intergenic
922567837 1:226612467-226612489 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
922681572 1:227602701-227602723 GGAAAGTGCTAGGAGGAGGAAGG - Intronic
922935570 1:229419822-229419844 GGAAAGTGCATGGAGGAAAAAGG + Intergenic
922962969 1:229663848-229663870 GGGAACTCCAAAGACGAGGAAGG - Intergenic
922979879 1:229816706-229816728 AGGAACTGGAAGGAGCAAAATGG + Intergenic
924437230 1:244052634-244052656 GTGAAATGGAGGGAGGAGAAAGG - Intronic
1062823383 10:551167-551189 GAGACCTGCAAGGAGGGGACTGG - Intronic
1064884944 10:20101406-20101428 GGAAACTTCAAGAAGCAGAAAGG - Intronic
1065091931 10:22244101-22244123 GGGGACTGCGGGGAGGAGGAGGG - Intergenic
1065151423 10:22826702-22826724 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1066212275 10:33251902-33251924 GGGAAGTGCAGGGTAGAGAAAGG + Intronic
1066765303 10:38797241-38797263 TGGAATAGAAAGGAGGAGAAAGG - Intergenic
1066774117 10:38871119-38871141 TGGAATTGAAAGGAGTAGAAAGG + Intergenic
1068022801 10:51605369-51605391 GGGAAGTGCTAGGTAGAGAAGGG - Intronic
1068700001 10:60009705-60009727 GGGAGCTGCATGGTAGAGAAGGG + Intergenic
1069060373 10:63888561-63888583 AGGAACAGCAAGGAGGTCAACGG + Intergenic
1069071538 10:63994810-63994832 GGGGACTCCAAGGAGGAGGCTGG - Intergenic
1070199128 10:74186220-74186242 GGGAAGGGAAAGGAGGGGAAGGG - Intronic
1070367864 10:75753543-75753565 GGCAAGTGCAAGGAGGAGAAAGG + Intronic
1072100724 10:92226854-92226876 GGGGCCTGGAAGGAGGGGAAGGG + Intronic
1072526009 10:96272329-96272351 GGCAAATGCAAGGAGGGGAATGG - Intergenic
1072815768 10:98507597-98507619 GAGAAATGCAAGGATGAAAAAGG - Intronic
1073170607 10:101504663-101504685 GGGAAATGGAAGGGGGAAAATGG - Intronic
1073411123 10:103342655-103342677 GGGAAAAGCAAGGTGCAGAAAGG - Intronic
1073976871 10:109112090-109112112 GGGAACTGGTGGGAGGAGACTGG + Intergenic
1074276258 10:112005410-112005432 GGGGGATGCCAGGAGGAGAAAGG + Intergenic
1074560872 10:114534201-114534223 GGGAACAGCAGGAAGGGGAAGGG + Intronic
1075579988 10:123610207-123610229 GTGGTCTGCATGGAGGAGAATGG + Intergenic
1075633273 10:124014114-124014136 GGGAACTCCAGGGAGGAGCCTGG - Intronic
1076080318 10:127574486-127574508 GGGAAGGGGAAGGAGGAGTAAGG + Intergenic
1076603848 10:131676946-131676968 GGGAACTGCCAGGAGGAATGTGG + Intergenic
1077031307 11:469148-469170 GGTAATTGGAAGGAGGAGGAGGG + Intronic
1077370042 11:2177530-2177552 GGGGACTGCCTGGAGGAGGAGGG - Intergenic
1077471214 11:2761557-2761579 GGGAAGTGCTGGGAGGAGAAGGG - Intronic
1078023092 11:7671588-7671610 GGGAACAGCAAGGAGGCTCAGGG + Intronic
1078038365 11:7833066-7833088 GGGAAGTGGAAGGAGGGAAAAGG - Intergenic
1078064013 11:8066140-8066162 GGGTACTGCCAGGGGAAGAATGG + Intronic
1078406382 11:11073792-11073814 GGGACCTGCAAGGATGAGCCAGG + Intergenic
1079097058 11:17517776-17517798 GGGAAGTGCAGTGAGGAGGATGG + Intronic
1079902493 11:26204600-26204622 TGTGACTGCAAGGAGGAGGATGG - Intergenic
1080873658 11:36258392-36258414 GGAAAGTGCAGGGAGGAGAGGGG + Intergenic
1081482673 11:43504229-43504251 GAGAACAGAAAGGAGGAGGAAGG - Intergenic
1081847218 11:46249335-46249357 GGAAGCTGGAAGGGGGAGAATGG - Intergenic
1083119723 11:60499397-60499419 GGTGACAGCAAGGATGAGAATGG + Intronic
1083455175 11:62773952-62773974 AGGAACTGAAAGGAGGACACAGG + Intronic
1083573308 11:63771500-63771522 GGGTATTGCCAGAAGGAGAAAGG + Intergenic
1085000192 11:73026738-73026760 GGGACCTGCTAGGAGGTGATTGG + Intronic
1085300925 11:75457782-75457804 GGTACCTGCCAGGAGGAGAGGGG + Exonic
1085626715 11:78079539-78079561 GGGATCGGCTGGGAGGAGAAGGG - Intronic
1086946698 11:92850866-92850888 GGAACATGCAGGGAGGAGAAGGG - Intronic
1087202623 11:95361241-95361263 AGAAACTGAAAGGAGGAGCAGGG - Intergenic
1087486573 11:98764627-98764649 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
1087501446 11:98959551-98959573 GGGAAGTGGAGGCAGGAGAATGG + Intergenic
1087677019 11:101175316-101175338 GGGAAATGCTAGGTGGTGAAGGG + Intergenic
1087701420 11:101440530-101440552 TGGAACAGCGAGGAGGAGAGGGG - Intergenic
1087793461 11:102431572-102431594 TGGAACTGCAGAGAGTAGAATGG - Intronic
1087793944 11:102435865-102435887 GGGAACAGCAGGTAGGATAAGGG + Intronic
1088221086 11:107570479-107570501 GGGAAATGCTGGGAGGAGAAGGG - Intergenic
1088797425 11:113275172-113275194 GGGGACAGCAGGGAGGAGGAGGG - Intronic
1088922924 11:114274626-114274648 TGGAACTGCAGGAAGAAGAAAGG + Intronic
1090830963 11:130420564-130420586 TGGGAGTGGAAGGAGGAGAAAGG + Intronic
1090950928 11:131472650-131472672 GGTAAAGGCAATGAGGAGAAGGG + Intronic
1090951476 11:131477105-131477127 GGGTAATGCTTGGAGGAGAAAGG + Intronic
1090986846 11:131774919-131774941 GGGAACGGAGAGGAAGAGAAAGG - Intronic
1091025590 11:132138066-132138088 GTAAACAGCAAGGAGGAGTAAGG - Intronic
1091026246 11:132143840-132143862 GGGGTCTGCAAGGAGCATAAGGG + Intronic
1091263376 11:134251787-134251809 GGCACCTTCAAGGAGCAGAAAGG - Intronic
1092254591 12:6919504-6919526 GGGATGGGCAAGGAGGAGGAGGG - Intronic
1092262186 12:6958702-6958724 GGGGGCTGCAAGGAGGAGCAGGG + Intronic
1092585752 12:9899513-9899535 GGTATCTGCTAGGAAGAGAAGGG - Intronic
1092902352 12:13071753-13071775 GAGAATTTCAAGGAGGAGTAAGG + Intronic
1093349023 12:18073005-18073027 GGGAAGTGCTGTGAGGAGAAGGG - Intergenic
1094368324 12:29707523-29707545 GAGATCTTCAAAGAGGAGAAAGG - Intronic
1094406394 12:30121081-30121103 GGGAAGTACTGGGAGGAGAAGGG + Intergenic
1094509471 12:31087715-31087737 GGGAAATGTAAAAAGGAGAAAGG - Intronic
1095477466 12:42600485-42600507 AGGAAGAGCAAGGAGGAGAAAGG - Intergenic
1095516738 12:43014749-43014771 GAGAACAGCAAGGAGGAAATCGG - Intergenic
1095773966 12:45991827-45991849 GGGAGCCGCAAGCAGGACAAGGG - Intronic
1095980811 12:47973749-47973771 GGGAAGGGCAGGGTGGAGAAGGG - Intronic
1095999786 12:48119488-48119510 GAGAACTGAAAGGAGCAGAAAGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096247035 12:49996811-49996833 GGGAAGAGCAAGAAGGAAAAAGG + Intronic
1096621733 12:52869630-52869652 GTCAAATGCAAGGAGGAGCAGGG + Intergenic
1096712364 12:53466764-53466786 GGAGACTGCAAGGAGGAGAGAGG - Intronic
1096712436 12:53467203-53467225 GTCAACTGCAAGGAGGAAACAGG - Exonic
1096977257 12:55706702-55706724 GGGAAGGGCCAGGAGGAGTAAGG - Intronic
1097179757 12:57165060-57165082 GGGAACAGCAGTGAGGAGCAAGG + Intronic
1098445637 12:70563140-70563162 GGGAAATGCAGTGAGGAGAAGGG + Intronic
1098805559 12:75016814-75016836 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1099380344 12:81945304-81945326 GGGAGTGGTAAGGAGGAGAATGG - Intergenic
1099640773 12:85280594-85280616 GGGACCTGGAAGGTGGAGGAAGG + Intronic
1101909194 12:108849944-108849966 GGGAGCTCCAAGGGGGAGCATGG + Intronic
1102891218 12:116559823-116559845 GGGAAGTGAGAGGAGGAGGAGGG + Intergenic
1102913628 12:116737407-116737429 GGGGACAGAAAGGAGGAGGACGG + Intronic
1103228783 12:119310224-119310246 TGGAATTGAAATGAGGAGAAAGG - Intergenic
1103488265 12:121296962-121296984 GCGAAGGGCAAGGAGCAGAAAGG + Intronic
1104077866 12:125406516-125406538 TGGAAATGCAAAGAGGAGCATGG - Intronic
1104082312 12:125440927-125440949 GGGAACAGCAGGGAGCAGAGGGG - Intronic
1104171177 12:126282579-126282601 GGGAACTTCAAGGAAGAGACAGG - Intergenic
1104238377 12:126961600-126961622 GGGAAGTGCTAGGTAGAGAAGGG - Intergenic
1104342362 12:127962616-127962638 GGGAACTGCAAGATGCAGGATGG - Intergenic
1104807049 12:131596324-131596346 GGGAACTGAAACCTGGAGAAAGG + Intergenic
1105454862 13:20531017-20531039 GGGACCTGCTAGGAGGTGATTGG + Intergenic
1105742992 13:23348401-23348423 GGGGACCGCATGGAGGAGATGGG - Intronic
1105754433 13:23451794-23451816 GTGCACAGCAAGGAGGAGATGGG - Intergenic
1106356943 13:28992093-28992115 GGGAACTACAGAGAAGAGAAGGG - Intronic
1109049677 13:57462713-57462735 GGAAAGTCCAAGGAGGAGAAAGG + Intergenic
1109388820 13:61667412-61667434 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1109561298 13:64053247-64053269 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1109940891 13:69362419-69362441 TGTCACTGCAAGGAGGAGAATGG + Intergenic
1110868016 13:80420017-80420039 GGGAAGAGAAGGGAGGAGAAGGG - Intergenic
1110990621 13:82038798-82038820 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1111156834 13:84338399-84338421 GGGAAGTGATGGGAGGAGAATGG - Intergenic
1111909368 13:94293292-94293314 GGGAACTGGTAGGAGGTGATTGG + Intronic
1112520024 13:100087018-100087040 GCAAACTGGAAAGAGGAGAAGGG + Intergenic
1112916449 13:104556451-104556473 GGGAAGAGCAAAGAGGACAAGGG - Intergenic
1112924405 13:104656152-104656174 GAGAATTCCAAGGAGGAAAAAGG + Intergenic
1113124844 13:106965841-106965863 GAGAACAGAAAGGAGGAGAAAGG - Intergenic
1114468205 14:22939818-22939840 GGGGACTGCTAGAAGGGGAAGGG + Intergenic
1114552664 14:23542325-23542347 GGGAGCAGACAGGAGGAGAAGGG + Intronic
1116913582 14:50497988-50498010 GGGTAATGGAAGGAGGAGAGAGG + Intronic
1117256871 14:53986624-53986646 GGGGACTGTTAGGAGGACAAGGG + Intergenic
1118459539 14:65975987-65976009 GAGAACGGGGAGGAGGAGAAGGG + Intronic
1118656342 14:67953885-67953907 GAGAATTGCAAAGAAGAGAAAGG + Intronic
1118929280 14:70225300-70225322 GGGAAATGCTAGGAAGGGAAGGG + Intergenic
1119102118 14:71889484-71889506 GGAAACTGGAGGGTGGAGAAGGG + Intergenic
1119382033 14:74235341-74235363 GGAAAATGCAGGGAGGAGACAGG - Intergenic
1119555824 14:75551553-75551575 GGGAATTCCAAGGGGGAGAAAGG + Intergenic
1119884575 14:78129622-78129644 CGGAGCAGCAAGGAGGAGCAGGG + Intergenic
1120003257 14:79327596-79327618 CTGAACTGCACTGAGGAGAAGGG - Intronic
1122415101 14:101545611-101545633 GGGGATTGCAAGGAAGAGGAGGG + Intergenic
1122498487 14:102177016-102177038 GGTAACTGCAAGGTGGGGCACGG - Intronic
1123824092 15:24063477-24063499 GGGAAGTGCTGGGAAGAGAATGG - Intergenic
1125185205 15:36922130-36922152 AAGAACTGGAAGGAGTAGAAGGG + Intronic
1125213419 15:37240990-37241012 AGGAACTGAAATGAAGAGAAGGG + Intergenic
1125834762 15:42739190-42739212 GGGAGCTGCTTGGAGGGGAAAGG + Exonic
1126223504 15:46242672-46242694 GGCGACTGCAAGGATGAGAAAGG - Intergenic
1127743990 15:61944983-61945005 GGGAACTGGTAGGAGGTGACTGG + Intronic
1128227977 15:66015779-66015801 GGGAACTGCAAGGTGGCCACCGG + Intronic
1129099393 15:73245193-73245215 GGGAAATGTAAGGATGACAAAGG - Intronic
1129156212 15:73719739-73719761 GAGAGCTGCAAGGAGGAGGGTGG - Intergenic
1129333558 15:74839709-74839731 GGGAGCTGCAGGGAAGGGAACGG + Exonic
1129852441 15:78801332-78801354 AGGAACTGCAAGGAGGCCAGTGG - Intronic
1130250542 15:82297744-82297766 AGGAACTGCAAGGAGGCCAGTGG + Intergenic
1130553590 15:84907747-84907769 GGGAACTGCAAGCTGGTGAGAGG - Intronic
1130719247 15:86370753-86370775 GAGGAGTGGAAGGAGGAGAAAGG - Intronic
1130927418 15:88396048-88396070 GGGAAGTGCTGGGAGGAGAAGGG - Intergenic
1130987236 15:88852467-88852489 GGGAAATGGAAGGAGGAGAAAGG - Intronic
1131955569 15:97731696-97731718 TGGAACTGTAAGGCAGAGAATGG + Intergenic
1133337466 16:5015342-5015364 GCAAGCTGCAGGGAGGAGAAGGG - Exonic
1133750627 16:8722591-8722613 GGGAAATGCATGGGGGAGATTGG + Intronic
1133816649 16:9202862-9202884 GGGAATAGCAAGGGGCAGAAAGG - Intergenic
1133864299 16:9627348-9627370 GGGAAGTGAGAGAAGGAGAAGGG + Intergenic
1134167372 16:11941396-11941418 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1134233758 16:12449749-12449771 TGGAGTTGCAAGGAAGAGAAGGG - Intronic
1134415250 16:14037861-14037883 TGGAACTCCAATTAGGAGAAAGG + Intergenic
1134422824 16:14110719-14110741 TGGAGCAGCGAGGAGGAGAAAGG - Intronic
1134493320 16:14712285-14712307 GGGAAGGGAAAGGAGGAGAAGGG - Intronic
1134498701 16:14751409-14751431 GGGAAGGGAAAGGAGGAGAAGGG - Intronic
1134525255 16:14938039-14938061 GGGAAGGGAAAGGAGGAGAAGGG - Intronic
1134581873 16:15377682-15377704 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1134712843 16:16336523-16336545 GGGAAGGGAAAGGAGGAGAAGGG - Intergenic
1134720708 16:16379841-16379863 GGGAAGGGAAAGGAGGAGAAGGG - Intronic
1134754068 16:16650764-16650786 GGGAAAGGAAAGGAGGGGAAGGG - Intergenic
1134946719 16:18332044-18332066 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1134953984 16:18372170-18372192 GGGAAGGGAAAGGAGGAGAAGGG + Intergenic
1134991991 16:18708280-18708302 GGGAAAGGAAAGGAGGGGAAGGG + Intergenic
1135077205 16:19403771-19403793 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1135137358 16:19895039-19895061 GGGAGCTGCGAGGTGGGGAAGGG + Intergenic
1135312805 16:21419044-21419066 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1135365728 16:21851324-21851346 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1135446086 16:22519838-22519860 GGGAAGGGAAAGGAGGAGAAGGG - Intronic
1135667949 16:24351610-24351632 GGGAAGGGGAAGGAGGGGAAGGG + Intronic
1135821455 16:25690312-25690334 AGGAACTGCAAGGAGGACCTGGG + Intergenic
1136168221 16:28470666-28470688 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1136194780 16:28644391-28644413 GGGAAGGGAAAGGAAGAGAAGGG - Intronic
1136309480 16:29397803-29397825 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1136322918 16:29499552-29499574 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1136387263 16:29936734-29936756 GGGAACTGCAGAGGGGAGGAAGG + Intergenic
1136437602 16:30239520-30239542 GGGAAGGGAAAGGAGGAGAAGGG + Intronic
1136532189 16:30877073-30877095 GTGAACAGCAAGGAGGAGAGTGG + Intronic
1137896063 16:52214090-52214112 TGGAAGGGGAAGGAGGAGAAGGG - Intergenic
1138185532 16:54974274-54974296 GGGAATTGCTAGGAGAAGCATGG - Intergenic
1138486396 16:57347546-57347568 GGGAACTGAAAGTTGGATAAAGG + Intergenic
1138708050 16:58937978-58938000 GGGAACTGCTGGGAGGTGATTGG - Intergenic
1139244057 16:65423606-65423628 GGGCACTGTTAGGAAGAGAAAGG - Intergenic
1139766585 16:69235592-69235614 GGGAACTAAAAGGAAGGGAAAGG + Intronic
1139857159 16:69990173-69990195 GGGAAGGGAAAGGAGGAGAAGGG + Intergenic
1140365515 16:74377753-74377775 GGGAAGGGAAAGGAGGAGAAGGG - Intergenic
1140374565 16:74434425-74434447 GGGACCTGTAAGGAAGGGAAGGG - Intergenic
1140748196 16:77999495-77999517 GGGAAATGCTAGGTAGAGAAGGG - Intergenic
1140956739 16:79873356-79873378 GGGAAGCGGAGGGAGGAGAATGG + Intergenic
1140975434 16:80055680-80055702 GTGAACTGCAAGCAGAAGGAGGG + Intergenic
1142359242 16:89619008-89619030 GGGAGCTGCAGGGAGGGGAGCGG - Intronic
1142359309 16:89619160-89619182 GGGAGCTGCAGGGAGGGGAGCGG - Intronic
1142359350 16:89619251-89619273 GGGAGCTGCAGGGAGGGGAGTGG - Intronic
1142359378 16:89619311-89619333 GGGAGCTGCAGGGAGGGGAGCGG - Intronic
1142526888 17:549100-549122 GGGAGCTGCAAGGCTCAGAAAGG - Intronic
1142878962 17:2869764-2869786 GGGAAATGTCAGGATGAGAAGGG - Intronic
1143233422 17:5377284-5377306 GAAAACTGCAAGGAGGAAATAGG + Exonic
1143889125 17:10088795-10088817 GGGAAAAGCTAGGAGGAGAGGGG + Intronic
1144230630 17:13199631-13199653 GGGAAGGGGAAGGAGGAGAAAGG - Intergenic
1144363971 17:14524341-14524363 GGGGAATGCAAAGAGGAGCAGGG - Intergenic
1144632704 17:16882152-16882174 GGGCCCTTCAAGGAGGAGAGGGG + Intergenic
1144737770 17:17564461-17564483 GGAAACTACAAGCAGGAGAGGGG + Intronic
1145065096 17:19756767-19756789 CGGAACAGCAAGGTCGAGAAGGG - Intergenic
1145126977 17:20309552-20309574 GGGGACTACAAGAGGGAGAAAGG - Intronic
1145338381 17:21932520-21932542 GGGAACTGAATGGAGTCGAATGG + Intergenic
1145359853 17:22203092-22203114 GAGAAGTGCATAGAGGAGAAGGG + Intronic
1145706038 17:26872341-26872363 TGGAATTGCAAGGAATAGAATGG + Intergenic
1145784609 17:27585930-27585952 GGGAAGGGCAAGGTGGAGACAGG - Intronic
1146133584 17:30298483-30298505 GGGAATTACAAGGATAAGAATGG - Intergenic
1146655026 17:34629990-34630012 GTGTCCTGCAGGGAGGAGAAGGG - Exonic
1147387038 17:40088959-40088981 GGGCAATGCAAGGAGGACAGAGG - Intronic
1147533018 17:41298225-41298247 GGGAAGTGCTGGGAGAAGAAGGG + Intergenic
1147626609 17:41904380-41904402 GGGAAGGGAAAGGAAGAGAAGGG + Intronic
1148649023 17:49236318-49236340 GGGGAAAGGAAGGAGGAGAAAGG + Intergenic
1148674771 17:49438867-49438889 GGGAGGCGCAAGAAGGAGAACGG + Intronic
1148770822 17:50064901-50064923 GGGAACTGCAAGGAGGAGAAAGG + Intronic
1149132241 17:53316472-53316494 GAGAAGTGCTGGGAGGAGAAGGG - Intergenic
1149236450 17:54596058-54596080 GCCATCTGCAAGGAGGAGCAAGG + Intergenic
1149457204 17:56797520-56797542 GGGCACAGCAGGGTGGAGAACGG + Intronic
1149585695 17:57784806-57784828 GGGAAAGGCAGGGAGGAGAGAGG - Intergenic
1151081759 17:71337244-71337266 GGGATCTAAAAGGTGGAGAAAGG + Intergenic
1151100510 17:71550819-71550841 GGGAAAGGGAAGGAGGGGAAAGG + Intergenic
1151259853 17:72907888-72907910 GAGAAGTGGAAGGAGGAGACAGG + Intronic
1151272492 17:73007689-73007711 GGGAGGGGCCAGGAGGAGAACGG + Intronic
1151671349 17:75573314-75573336 GGGCACTGCACGGACGGGAAGGG + Intronic
1151888531 17:76938414-76938436 TGGTACTGCAAGGGGGAGGATGG - Intronic
1152337072 17:79704874-79704896 GAGAACAGCAAGGAGGAAATCGG + Intergenic
1152524404 17:80879362-80879384 GGGAAGGGCAAGCAGGAGCAGGG - Intronic
1152785031 17:82243241-82243263 GGGAACTCTGGGGAGGAGAAGGG + Exonic
1203194322 17_KI270729v1_random:217732-217754 TGGAACTGAAAGGAATAGAATGG + Intergenic
1203203684 17_KI270730v1_random:17158-17180 TGGAACTGAAAGGAATAGAATGG + Intergenic
1203207991 17_KI270730v1_random:53909-53931 TGGAATTGAACGGAGGAGAATGG + Intergenic
1153357605 18:4155045-4155067 GGGAGGTGTAGGGAGGAGAAGGG + Intronic
1153526576 18:6000420-6000442 TGGAACTCGAAGGAGCAGAAAGG + Intronic
1153773687 18:8434927-8434949 GGGAAGTGCTAGGTAGAGAAAGG + Intergenic
1153986021 18:10351575-10351597 GGCAACTGCAGGGAGGAGAGCGG + Intergenic
1154058857 18:11039091-11039113 GGGAACAGAAAGGAAGGGAAAGG + Intronic
1154118611 18:11633424-11633446 GGGAAGGGAAAGGAGGAGAAGGG + Intergenic
1155784566 18:29880525-29880547 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1156270244 18:35523941-35523963 GGGGATGGCAGGGAGGAGAAGGG - Intergenic
1156277597 18:35598378-35598400 GGGAAGGGTAGGGAGGAGAAGGG - Intronic
1156439343 18:37167851-37167873 GGGAAGTGCAGGGATGAAAAGGG - Intronic
1156598842 18:38579802-38579824 GAGAAAGACAAGGAGGAGAAAGG + Intergenic
1157822120 18:50779677-50779699 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
1157896068 18:51469132-51469154 GGGAAATTCAATGAAGAGAAAGG - Intergenic
1158541828 18:58363808-58363830 GGGAAATACAACGAGCAGAAAGG - Intronic
1158604033 18:58879003-58879025 GAGAACTGCAAGTAGGACAGAGG - Intronic
1158937037 18:62374015-62374037 GTGAAATGCAAGGTGGTGAACGG - Intronic
1159424088 18:68261328-68261350 GGGAATGGGCAGGAGGAGAAAGG + Intergenic
1159505100 18:69326459-69326481 GGTAACTGAAAGGAGGTGCAAGG - Intergenic
1160003913 18:75053965-75053987 AGGAAATGAAAGCAGGAGAAAGG - Intronic
1160225694 18:77009201-77009223 GAGGACAGCCAGGAGGAGAAGGG - Intronic
1160243316 18:77137875-77137897 GGGAAATGCCAGGTGGAGAGGGG + Intergenic
1161139321 19:2638417-2638439 GGGAAGGGGAAGGAGGGGAAGGG + Intronic
1161349256 19:3783313-3783335 GGGACCGGGGAGGAGGAGAAAGG + Intronic
1162235808 19:9308812-9308834 GGAAACTGCAAGGAATAAAAAGG + Intronic
1162586065 19:11559259-11559281 GGGACCTGAAAGTAGGAGAGGGG - Intergenic
1162857948 19:13483472-13483494 GGGAAATGGGAGGTGGAGAACGG - Intronic
1163378457 19:16948821-16948843 GGGAAGGGAAGGGAGGAGAAGGG + Intronic
1163737332 19:18989625-18989647 GGAAGCTCCAGGGAGGAGAAAGG + Intergenic
1163775315 19:19213843-19213865 TGGAACTCCGTGGAGGAGAAAGG - Intronic
1165739449 19:38196651-38196673 GGGAAGAGCAAGGAGGCCAAGGG + Intronic
1165757936 19:38304917-38304939 GAGAAGGGCAAGAAGGAGAAGGG + Exonic
1165940074 19:39410475-39410497 GGAGACGGGAAGGAGGAGAAAGG - Intergenic
1165992628 19:39825371-39825393 GGGTACAGCGAGGAGGAGCAAGG + Exonic
1166378916 19:42344423-42344445 GGACACTGCGAGGAGGAGAGGGG - Exonic
1166832119 19:45645188-45645210 GGGACTTGCAAGGAGGAGGCTGG + Intronic
1167197988 19:48043912-48043934 GGGAACTGCATGGAGGGGTGGGG + Exonic
1167289034 19:48614623-48614645 GGGAGCTGCAAAGAGAAGAAAGG + Intronic
1167690071 19:50979920-50979942 GGTCACTGCAGGGAGGAGCAGGG + Exonic
1167735496 19:51292193-51292215 GGGAAGTGCCTGGAGGAAAACGG + Intergenic
1168200435 19:54811291-54811313 GGGAAGTTGAAGAAGGAGAATGG + Intronic
1168524229 19:57075959-57075981 GGAAACTGCATCGAGGAGATGGG - Intergenic
1168725877 19:58581733-58581755 GAGAACCGCAAGCAGGAGCAGGG + Intergenic
925092442 2:1166609-1166631 GGGAAGTGCTGGGAGGAGAAGGG + Intronic
925454034 2:3998847-3998869 GGGAACTGGTAGGAGGTGATTGG + Intergenic
926139186 2:10358365-10358387 GGGAAGTGCTGGGAGGAGAAGGG + Intronic
927220572 2:20704688-20704710 GGGAAGTGAGAGGAGAAGAAAGG - Intronic
927457740 2:23271668-23271690 GAGACCTTCTAGGAGGAGAAGGG - Intergenic
927529141 2:23777727-23777749 GTGAACTGCAAGACCGAGAATGG + Intronic
927598738 2:24421684-24421706 GGAAAATACAAGAAGGAGAAAGG - Intergenic
928537996 2:32258496-32258518 GGGAAGTGCTGGGAAGAGAAGGG - Intronic
928673817 2:33630341-33630363 GGGAAGTGCTGGAAGGAGAAGGG + Intergenic
928948484 2:36792822-36792844 GGGAAATGAAAGGCAGAGAAAGG - Intronic
928998973 2:37326449-37326471 GGGAAGTGAAAGGAAGAAAAGGG - Intergenic
929285861 2:40134484-40134506 GGGAACTGTGATGAGGAGCAAGG - Intronic
929628442 2:43434319-43434341 GGGAAGTGCTGGGAGGAGAAGGG + Intronic
930158489 2:48129173-48129195 GAGGACTGAATGGAGGAGAAAGG + Intergenic
930472081 2:51829764-51829786 GGGAAGGGAAAGGAAGAGAAGGG - Intergenic
930763571 2:55061753-55061775 GGGAAGTGCTGGGAGGAGAAAGG + Intronic
931212732 2:60213320-60213342 TGGCACAGCAAGGAGGAGAGTGG - Intergenic
931405626 2:61974783-61974805 GGAAACTGCAAGGGGGAGGAAGG - Intronic
931547784 2:63408401-63408423 GGGTAGTGCAAGTAGCAGAAAGG + Intronic
931586034 2:63829677-63829699 GGGAAATGGAAGGAAGCGAAAGG - Intergenic
931681126 2:64750818-64750840 GGGCGCTGCAAGCAGGAGCAGGG + Intronic
932079764 2:68702503-68702525 GGGGACTACTAGGAGGAGCAGGG + Intronic
932420667 2:71599562-71599584 GAGGCCTGGAAGGAGGAGAAGGG + Intronic
932445329 2:71777467-71777489 GGGAACTGGGAGGGGGAGATGGG + Intergenic
932681474 2:73829344-73829366 GGGAAATACGAGGAGGAGAAAGG - Exonic
933143383 2:78821463-78821485 GGGAATTTCAATAAGGAGAATGG - Intergenic
933200696 2:79444766-79444788 TGTCTCTGCAAGGAGGAGAAAGG + Intronic
933581731 2:84134654-84134676 GGGAGCTGGAGGCAGGAGAATGG + Intergenic
933789937 2:85875749-85875771 GGGAACTGGAAGGAAAAGACAGG + Intronic
934195599 2:89835482-89835504 GGGAACTGAAAGGAATGGAATGG + Intergenic
934566047 2:95341923-95341945 AGTAACTGCAAGGAGGGAAAAGG + Intronic
934734939 2:96685419-96685441 GAGGACTGCAAGTAGGAGTAGGG + Intergenic
934932088 2:98434944-98434966 GGGATTTGCTAGGAAGAGAAAGG + Intergenic
934991562 2:98925183-98925205 TGGGACTTCAAGGAGGAGGAAGG + Intronic
935111753 2:100100665-100100687 GGGAGATGCAAGGATGAGTAAGG - Intronic
935602012 2:104932285-104932307 AGGAAGTTCCAGGAGGAGAAGGG + Intergenic
935609894 2:105011360-105011382 GGTCAGTTCAAGGAGGAGAAGGG + Intergenic
936123212 2:109764503-109764525 GGGAGATGCAAGGATGAGTAAGG + Intergenic
936221470 2:110606966-110606988 GGGAGATGCAAGGATGAGTAAGG - Intergenic
936379386 2:111970688-111970710 GGGAGGTGGAAGGAGGAGGAGGG - Intronic
936840041 2:116758005-116758027 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937477412 2:122227754-122227776 GGGAAGTGTAAGGAGGAGGTGGG + Intergenic
937544507 2:123000668-123000690 TGTACCTGAAAGGAGGAGAATGG - Intergenic
937727676 2:125186652-125186674 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
937727680 2:125186674-125186696 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
937768190 2:125686199-125686221 GGCAACTGGAAGCTGGAGAAAGG - Intergenic
938088305 2:128416344-128416366 GGGGACTGCAGGGAAGGGAAGGG + Intergenic
938783230 2:134603859-134603881 GGGAACAGAAGGGAGGGGAAGGG + Intronic
939125305 2:138171142-138171164 GGGGACTACAAGAAGGAGGAAGG + Intergenic
939732285 2:145799514-145799536 GGGGAGTGGAAGGAGGAGAAAGG - Intergenic
939778387 2:146413492-146413514 GGGGAGTGCTTGGAGGAGAAGGG - Intergenic
940478164 2:154192408-154192430 GGGAAGAGCTGGGAGGAGAAGGG - Intronic
940981341 2:160007291-160007313 GGGAAGTGCTGGGAGGAGAAGGG + Intronic
941597731 2:167498782-167498804 GGGATCTGCAAGGAGAAGAAAGG - Intergenic
942989267 2:182179652-182179674 GGGTAGAGAAAGGAGGAGAAGGG - Intronic
943180921 2:184540263-184540285 GGGAAGTGGAGGGAAGAGAAGGG + Intergenic
943240454 2:185377277-185377299 GGGAAGTGCAAGGAGCGGGACGG - Intergenic
943420037 2:187658520-187658542 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
944636313 2:201679064-201679086 GGGAAGTGTTAGTAGGAGAAAGG - Intronic
945363442 2:208921373-208921395 GGGAACTACTAGCGGGAGAAGGG - Intergenic
945373351 2:209049035-209049057 GAGAATGGCAAGGAGGAAAAGGG + Intergenic
945569774 2:211451606-211451628 GGGAACAGCAAGGGGAGGAAAGG + Intronic
946475196 2:220000354-220000376 GACAGCTGCAAAGAGGAGAAGGG + Intergenic
946765360 2:223035673-223035695 GGGAACAGAGAGGAGGAGATGGG - Intergenic
947173517 2:227337055-227337077 TGGGACTGCAATGAGCAGAATGG + Intronic
947981717 2:234415991-234416013 AGGAACAGCAGGGAGGAGAGAGG + Intergenic
948091896 2:235302088-235302110 GGGGAATGGAAGGAGGAGGAGGG - Intergenic
948273296 2:236689909-236689931 GGGATCTGAAAGAAGGAGTAAGG - Intergenic
949022861 2:241751393-241751415 GGGACCTGCAAGCAGGACACAGG - Intronic
1169453962 20:5736006-5736028 GAGAACAGAAAGGAAGAGAAGGG + Intergenic
1169813231 20:9629945-9629967 GGAAACTGAAGGAAGGAGAAGGG + Intronic
1170292248 20:14783690-14783712 GGTAACTCCAAGTAGGAGAGAGG + Intronic
1170597410 20:17816464-17816486 GAAAACTGAAGGGAGGAGAAGGG + Intergenic
1170968873 20:21100957-21100979 GGGGACTGCGAGGAGCTGAAAGG - Intergenic
1171312132 20:24153054-24153076 GAGTAGGGCAAGGAGGAGAAAGG - Intergenic
1172496209 20:35386906-35386928 GGGAAGTGCAAGGACAAGAGTGG - Intronic
1173201867 20:40960593-40960615 GGGGACTGCCAGGTGGAGAGGGG + Intergenic
1173351964 20:42253533-42253555 GGGAACTGGGAGAAGGAGGAGGG + Intronic
1173421404 20:42904588-42904610 GGGAAGTGCTGGGAAGAGAAGGG + Intronic
1174913074 20:54627527-54627549 GGGAACTGAAAGGAAGAAACAGG + Intronic
1175304263 20:57965219-57965241 GGGCAGTGGAAGGAAGAGAAAGG - Intergenic
1175580596 20:60095815-60095837 AGGAACTGACAGAAGGAGAAAGG + Intergenic
1175891526 20:62318068-62318090 GGGAAATGAGAGGAGGAGAAGGG + Intronic
1176168159 20:63685332-63685354 GGTCCCTGCAGGGAGGAGAAAGG + Intronic
1176864530 21:14038214-14038236 TGCGACTGCAAGGATGAGAAAGG - Intergenic
1177339459 21:19781749-19781771 GGGAAGTGCTGGGAGGAGAAGGG + Intergenic
1177662594 21:24105490-24105512 GGGGACTGCTAGGAGGGGGAGGG + Intergenic
1178040740 21:28638344-28638366 AGGAACTGGAAGGAGGAGCACGG + Intergenic
1178474816 21:32928547-32928569 GGGATATGCAAGAAGGAGAAAGG - Intergenic
1179320656 21:40287921-40287943 GGAAACTACAATGAGCAGAAAGG + Intronic
1179452086 21:41474248-41474270 GGGATGAGCAAGGAGGTGAAAGG + Intronic
1179470340 21:41606005-41606027 GGGGAAGGCGAGGAGGAGAACGG - Intergenic
1179598786 21:42461741-42461763 GGGAGGTGAAAGGAGGAGAGAGG - Intergenic
1180206927 21:46266469-46266491 CAGAACTGGAAGGAGGAGACAGG + Intronic
1180663749 22:17492827-17492849 GGGAATTGCAAGGAGATGAATGG + Intronic
1180726737 22:17952081-17952103 ATGAACTGCAAGGATGGGAACGG + Intronic
1181333322 22:22111425-22111447 GGGAGCAGCAGGGAGGAGCAGGG - Intergenic
1181345564 22:22217973-22217995 GGGCACTGCTAGGAGGGGGAGGG - Intergenic
1181508456 22:23377607-23377629 GAGAAGGGGAAGGAGGAGAAAGG + Intergenic
1181989629 22:26827608-26827630 GGGAATTGGAAGGGGGAGTAAGG - Intergenic
1182398672 22:30057023-30057045 GGGAAGTTCCAGAAGGAGAAGGG + Intergenic
1183232780 22:36593290-36593312 GGAATCTGCAAGGATGATAACGG + Intronic
1183848404 22:40562587-40562609 GGGAAAGGGAAGGAGGGGAAGGG + Intronic
1183983439 22:41555922-41555944 TGGAACAGCATGTAGGAGAAGGG - Intergenic
1185011643 22:48317870-48317892 GGGTACTCCAAGGAGGGGAAGGG - Intergenic
949732927 3:7134723-7134745 GGGAACTGTAACCAAGAGAAAGG + Intronic
950367388 3:12497202-12497224 TGGCACTGCAGAGAGGAGAAGGG - Intronic
950444803 3:13030637-13030659 GAGTACTGCAAGGATGAAAAAGG + Intronic
950681097 3:14585590-14585612 GTGAGCTGCAAGGAGGAGGCAGG + Intergenic
950973512 3:17214992-17215014 GCTAAGAGCAAGGAGGAGAAGGG + Intronic
951549316 3:23861422-23861444 GGGAAGTGCTGGGAGGAGAAGGG + Intronic
951630078 3:24710290-24710312 AGAAACTGCAAGAGGGAGAAGGG - Intergenic
951789388 3:26462776-26462798 GGGCAATGCAAGGGGAAGAATGG + Intergenic
952154593 3:30629033-30629055 GGGAAATGGAAGGAGAAGCAGGG - Intronic
952193323 3:31046741-31046763 GGTATCTGCCAGGAAGAGAAGGG + Intergenic
952637108 3:35545766-35545788 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
952750126 3:36818089-36818111 GGAAACTGAAAGGAGGAAAGTGG + Intergenic
952809931 3:37392663-37392685 GGAAACTGCAAGGTGGACATTGG - Intronic
953259536 3:41324120-41324142 GTGAATTGAAAGGAAGAGAATGG - Intronic
953856113 3:46500283-46500305 GGGAACTGCCAGAGAGAGAAAGG - Intronic
953983727 3:47426065-47426087 GTGCACTTCAAGGAGGAGATTGG - Exonic
954575313 3:51672431-51672453 GGGAAGTGAGAGGAAGAGAAAGG + Intronic
954729674 3:52649088-52649110 GCGAAATGGAAGGTGGAGAAGGG + Intronic
955130272 3:56158957-56158979 GGGGCCTGCAAGGAGGTGACTGG + Intronic
955453321 3:59093985-59094007 GAGAACTGAAAGAAGGGGAAGGG - Intergenic
955584677 3:60463525-60463547 GAGAAATGGAAGGAGGAGAAAGG - Intronic
955679221 3:61482954-61482976 AGGAACTGGAGGGAGGAGGAAGG - Intergenic
956390764 3:68770771-68770793 GGGAAGTGCCAGGTAGAGAAGGG + Intronic
956594350 3:70949586-70949608 GGGACCTGCAGGGAGAAGGAGGG + Intergenic
957398537 3:79677407-79677429 GTGGAAGGCAAGGAGGAGAAAGG + Intronic
957595778 3:82263800-82263822 GGGGACTAGAAGGAGGAGGAGGG + Intergenic
958750756 3:98191703-98191725 GGGAACTGAAATTAAGAGAAGGG - Intronic
958942500 3:100331574-100331596 GGGAACTGAAAGGAGGAATCAGG + Intergenic
959200314 3:103237572-103237594 GGGAACTACAGGGAACAGAAAGG + Intergenic
959431607 3:106260861-106260883 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
959431627 3:106260999-106261021 GAGAAATCCAAGGAGAAGAAAGG - Intergenic
960463306 3:117964033-117964055 GGGACCTGCTGGGAGGTGAATGG + Intergenic
960526318 3:118715094-118715116 TGGAAAAACAAGGAGGAGAAAGG - Intergenic
960707075 3:120491862-120491884 GGGAACAGGAAGGGGGAGAGGGG + Intergenic
960723199 3:120644744-120644766 GAGAACTGAAAAGAGGAAAAGGG + Intronic
960899206 3:122537769-122537791 GGGAAATGGGAGGAGGAGAAAGG - Intronic
961530457 3:127537157-127537179 GGGGCCTGCAAGGAGGAGGAAGG - Intergenic
961635806 3:128331550-128331572 GGGAGATGCATGGAGGAGAAGGG - Intronic
961826728 3:129603139-129603161 GGGCACGGCGAAGAGGAGAAGGG + Intronic
961922041 3:130437086-130437108 GATAACTGCAAGTAGAAGAATGG - Intronic
962095193 3:132285580-132285602 GGGAAGTGCTGGGCGGAGAAGGG - Intergenic
962374905 3:134851377-134851399 GGGAAGTGCAAAGAGGAGAGGGG - Intronic
962643312 3:137411146-137411168 GGGAACTGCAAGGTGGCAAAAGG - Intergenic
963051916 3:141150037-141150059 GGAAACTGCAAGGAGGAGCGGGG + Intergenic
963592578 3:147280904-147280926 GGGAAGGAAAAGGAGGAGAAAGG + Intergenic
963761763 3:149292141-149292163 GGGAAGGGAAAGGAGGAGATGGG - Intergenic
963947419 3:151161476-151161498 GGGAAGTCCATGGAGGAGACCGG + Intronic
965008492 3:163056438-163056460 GAGAGCAGAAAGGAGGAGAAGGG - Intergenic
966099186 3:176245390-176245412 GGGAAACAGAAGGAGGAGAAGGG + Intergenic
966523694 3:180899185-180899207 GGTATCTGCTAGGAAGAGAAGGG + Intronic
966981362 3:185139161-185139183 AGGAGCAGAAAGGAGGAGAAGGG + Intronic
967612646 3:191525882-191525904 GGGAACTGAAAGTTGGAGAAAGG + Intergenic
967920266 3:194609229-194609251 GGGAACTGAGGGGAGGGGAAAGG + Intronic
968054401 3:195680488-195680510 GGGAGAAGCAAGGAGGAGGAGGG + Intergenic
968101490 3:195968670-195968692 GGGAGAAGCAAGGAGGAGGAGGG - Intergenic
968611347 4:1558599-1558621 GGGAAGGGAAGGGAGGAGAAGGG + Intergenic
968908595 4:3465578-3465600 GAAAAACGCAAGGAGGAGAAAGG - Intronic
968919412 4:3514995-3515017 GTGAACTGCAAGGACGCCAAAGG + Intronic
968976483 4:3824774-3824796 GGGAACGGCCAGGAGGGGGATGG - Intergenic
969986370 4:11215296-11215318 GGGAACTGGTAGGAGGTGATTGG - Intergenic
970368938 4:15388922-15388944 GGAAAGAGCAAGGAGGAGCAGGG + Intronic
970574306 4:17412392-17412414 GGGAAATGCAGGGTAGAGAAGGG - Intergenic
971907625 4:32748049-32748071 GGGAAGTGCTGGGAAGAGAAGGG + Intergenic
971953414 4:33383523-33383545 GGGAAGTGGAAGGAAGATAAGGG - Intergenic
972697566 4:41463105-41463127 GGGACCTTCCAGGAGGTGAATGG - Intronic
972755256 4:42040148-42040170 GAGTACTGGAAGGAGGAGCAGGG + Intronic
972940136 4:44185937-44185959 GGGAAGTGCTGGGAGGAAAAGGG + Intronic
974653880 4:64792941-64792963 GGAAACTTCCAGGAGGAGATTGG - Intergenic
974975054 4:68881243-68881265 GGGAACTGCAGGGAGGAGAAGGG - Intergenic
975134198 4:70858251-70858273 GGGGACTGTAAGGAGAAGGAAGG + Intergenic
976637910 4:87306605-87306627 GGCAACTGAAAGGAAGAGAGTGG + Intronic
976740161 4:88348520-88348542 GGGAACTGAAATTAAGAGAAGGG + Intergenic
977472170 4:97455221-97455243 GGGAAGTGCTGGGAAGAGAATGG + Intronic
978264183 4:106803046-106803068 GGGAACGGAAAGGAGAAGAAAGG - Intergenic
978414701 4:108463363-108463385 GGGAAATGCTGGGAGGAGAAGGG + Intergenic
978491630 4:109316795-109316817 GGGAAGGGAAAGGAGGAGACAGG - Intergenic
978655545 4:111061557-111061579 GGGAACTGTAAGGAGGAGAGAGG + Intergenic
979500753 4:121437065-121437087 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
980665960 4:135935911-135935933 GGGAAGTGCTAGGAGGAGAAGGG - Intergenic
980974406 4:139597396-139597418 GGGAACTGCTTTAAGGAGAAAGG - Intronic
981255916 4:142660315-142660337 GGTATCTGCTAGGAAGAGAAGGG + Intronic
981540733 4:145843922-145843944 GGAACCTGCAAGGAGGTGATGGG - Intronic
981886143 4:149675337-149675359 GGAAACAGCAATGAGGAGCAAGG + Intergenic
982504099 4:156196612-156196634 GGGAAGTGCTAAGAAGAGAATGG + Intergenic
983067564 4:163228768-163228790 GGGAAGGGAAAGGAAGAGAAAGG + Intergenic
983996156 4:174184868-174184890 GGAAAATGCAAGCAGGATAAGGG - Intergenic
984155290 4:176189206-176189228 ACGAACTGAAAGGAGGTGAAGGG + Intronic
984548398 4:181133175-181133197 AGGTAGAGCAAGGAGGAGAAAGG - Intergenic
984964851 4:185130744-185130766 GACAACTGGAAGGAGGAGAGCGG + Intergenic
984991085 4:185382026-185382048 AGGAACTGAAGGGAGGAGAATGG - Intronic
985091615 4:186368633-186368655 GGGCAATGCAAGGTGGAAAATGG - Intergenic
985219310 4:187685737-187685759 TGGAGCTGCAAATAGGAGAAAGG - Intergenic
985501469 5:250286-250308 GGGAGAAGCAAGGAGGAGGAGGG + Intronic
985735413 5:1577348-1577370 GGGAGAAGCAAGGAGGAGGAGGG - Intergenic
986035092 5:3929751-3929773 GAGAAGTGAAGGGAGGAGAAGGG + Intergenic
986153562 5:5150710-5150732 GAGAACGGCAAGGAAGAAAATGG + Intronic
986165346 5:5267836-5267858 GGGAAGTGCTGGGAGGAGAAGGG - Intronic
986213730 5:5698671-5698693 TGTATCTGCTAGGAGGAGAAGGG + Intergenic
986240333 5:5954837-5954859 GGGAAGGGCAAGGAGGAAAGGGG - Intergenic
986329723 5:6708780-6708802 GGGCACTGGAAGGGGGAGAATGG - Intergenic
987230346 5:15887359-15887381 TGGAAGGGCAAGCAGGAGAATGG + Intronic
987589447 5:19904401-19904423 GGGAAGGGAAAGGAAGAGAAGGG + Intronic
988489801 5:31696756-31696778 GGAAATTGTAAAGAGGAGAAAGG - Intronic
988581707 5:32474250-32474272 GAATACTGCCAGGAGGAGAAAGG - Intergenic
988604056 5:32665275-32665297 GGGAAGGGAAAGGAGGAGATGGG + Intergenic
989634569 5:43520511-43520533 TGGAACTGCTAAGTGGAGAAAGG + Intergenic
990976884 5:61568469-61568491 GGGAAGGGAAAGGAGGGGAAGGG - Intergenic
990995648 5:61729867-61729889 GGGAAGTGTAGGGAGGAGAGGGG + Intronic
991110811 5:62897090-62897112 GGGAAGTGCAAGGAGCAGGGAGG - Intergenic
991198087 5:63959658-63959680 GGGGAGAGCAAGGAGGAGGAGGG - Intergenic
993143831 5:84069693-84069715 GGGAAGTGCTGGGAGGAGAAGGG + Intronic
993538645 5:89120280-89120302 GGGAAGGGAAAGGAGGAAAAAGG + Intergenic
995393521 5:111664024-111664046 GGTATCTGCTAGGAAGAGAAGGG - Intronic
996182138 5:120432212-120432234 GGGAGCTGCATGGGGGAAAAGGG - Intergenic
996207411 5:120758538-120758560 GGGATCTGCTAGGAGGTGACTGG + Intergenic
997464043 5:134074796-134074818 GGGAACTCCAAGCAGATGAAGGG + Intergenic
997610522 5:135212675-135212697 GGGAACTGGAAGGAGCAGAGAGG + Intronic
997837762 5:137210057-137210079 TGGAAATGCAAGGAGAAGAAGGG - Intronic
998352694 5:141511699-141511721 GGGCTCTGGAAGGAGGTGAAGGG - Exonic
998934841 5:147224110-147224132 GTGATCTGCAAAGAGCAGAAGGG + Intergenic
999263312 5:150250806-150250828 GGGAACTGGAAGGGGCAGAGAGG + Exonic
999336228 5:150719327-150719349 GAGGACTCCAAGGAAGAGAAGGG + Intronic
999377360 5:151096020-151096042 GGGACCAGCATGGAGGAGACAGG - Intergenic
999407343 5:151317945-151317967 GGGAAAAGGAGGGAGGAGAAAGG + Intronic
1000131588 5:158305144-158305166 GGGAACAGAAAGGAAAAGAAAGG + Intergenic
1000248581 5:159470872-159470894 GGAAAATGCAAAGAGAAGAAGGG - Intergenic
1000740421 5:164962565-164962587 GGAGATTGCATGGAGGAGAAAGG - Intergenic
1001289099 5:170443860-170443882 AGGAAGTGGAAGGAAGAGAAAGG + Intronic
1001335109 5:170790418-170790440 GGGAGGAGCAAGGAGGAGAAGGG - Intronic
1001443412 5:171763604-171763626 GAGCAGAGCAAGGAGGAGAAAGG + Intergenic
1001514324 5:172344906-172344928 GGGAAAAGGAAGGAGGAGGATGG + Intronic
1002033384 5:176447428-176447450 GGGGACTGCCTCGAGGAGAAGGG + Intergenic
1002049328 5:176561061-176561083 GGGAACTCCAACAATGAGAAGGG + Intronic
1002299504 5:178249254-178249276 GGGACCTGCTGGGGGGAGAAGGG - Intronic
1002962155 6:1925723-1925745 GGGAAGTGCCGGGAGGAGAAGGG + Intronic
1004189146 6:13448972-13448994 GGCAACTGCAAGAAGAAGAAAGG + Intronic
1004871347 6:19907645-19907667 GGGAACTCCTAGGATGAGACTGG - Intergenic
1005453734 6:25999130-25999152 GTGAACAGCAAAGAGTAGAAAGG - Intergenic
1005495401 6:26383568-26383590 GGGAAGAGGAAGGAGGAAAACGG + Intronic
1005589560 6:27310366-27310388 GGGGTCTGCTTGGAGGAGAAAGG + Exonic
1007365401 6:41388299-41388321 GGACAGTGCAATGAGGAGAATGG - Intergenic
1008420826 6:51297478-51297500 GGGGAATGCAAAGGGGAGAAAGG - Intergenic
1008727736 6:54442101-54442123 GGGAGGTGCTGGGAGGAGAAGGG - Intergenic
1009567351 6:65325631-65325653 GGGGACTGTGAGGAGGAGAAGGG + Intronic
1010373945 6:75144447-75144469 AGGCACTTCAAGGAGGAAAAAGG - Intronic
1010733339 6:79413631-79413653 AAAAACTGCAAGGAGCAGAAAGG - Intergenic
1011591111 6:88971714-88971736 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
1011937607 6:92800441-92800463 GGGAGCTTCAAGAAGGAGAGAGG - Intergenic
1011942860 6:92864631-92864653 GACATGTGCAAGGAGGAGAATGG + Intergenic
1012072361 6:94639564-94639586 GGGAAGTGCTGGGAGGAAAAGGG + Intergenic
1012637941 6:101570479-101570501 GGGAGCTGGCAGGGGGAGAAGGG - Intronic
1012866956 6:104630080-104630102 GGAAACAGCAAGGCGGAGAGAGG - Intergenic
1014154941 6:118099513-118099535 GGGAACAGGAGGGAGGAGAGAGG - Intronic
1014365005 6:120528902-120528924 AGGAACTAGAAGGAGGAGCAGGG - Intergenic
1014527186 6:122514762-122514784 GGGAAGTGGAAAGGGGAGAAGGG + Intronic
1015113552 6:129619948-129619970 GGGGAGGGAAAGGAGGAGAAGGG + Intronic
1015729538 6:136334346-136334368 GGGAGGTGCTGGGAGGAGAAGGG + Intergenic
1015966748 6:138701948-138701970 GAGAACTGAAATGAAGAGAAGGG - Intergenic
1015974998 6:138781062-138781084 GGGAAGTGGAAGTAGCAGAAGGG - Intronic
1016303895 6:142662739-142662761 GGGACCTGGTAGGAGGAGATTGG - Intergenic
1016592743 6:145764899-145764921 GGGAAGGCAAAGGAGGAGAAAGG - Intergenic
1016766611 6:147801466-147801488 GGAACCAGCAAGAAGGAGAAAGG + Intergenic
1016986561 6:149900010-149900032 GGAAAAGGCAAGGAGGAGACAGG - Intergenic
1017433180 6:154391336-154391358 GGGAAGTTGAGGGAGGAGAATGG - Exonic
1018346028 6:162899992-162900014 GGGAGCTGCAGGGAGCAAAAGGG + Intronic
1018713181 6:166512306-166512328 AGGAGCTGGAAGGGGGAGAATGG + Intronic
1018807402 6:167271904-167271926 GGGAAATGAATGGAGGATAAGGG + Intronic
1018936821 6:168279171-168279193 GAGAATGGGAAGGAGGAGAATGG + Intergenic
1019305195 7:331024-331046 GGGCAGTGCAGGGAGGACAATGG - Intergenic
1019429120 7:990637-990659 GGCTGCTGCAAGGACGAGAAGGG + Intergenic
1019685502 7:2379767-2379789 GGGAAGTGCCAGGAAGAGGAGGG + Intronic
1019717685 7:2547541-2547563 GGGAATTGCTAGGAGAAGAGCGG - Intronic
1019893521 7:3965670-3965692 AGGGTCTGCAGGGAGGAGAAAGG + Intronic
1020410262 7:7884468-7884490 TTGAACTTCAAGGAGGAGGAAGG + Intronic
1021912739 7:25402558-25402580 TGGAAATGCTAGGAGGAGATAGG - Intergenic
1021952815 7:25791629-25791651 GGGAACTACAAGAAGGAGGAGGG - Intergenic
1022034531 7:26521128-26521150 AGGAAATGCAGGGAGGAGAATGG + Intergenic
1022498319 7:30866863-30866885 GGGACCTGCAAGGAGGAAGAAGG - Intronic
1022670308 7:32449378-32449400 GGGAACGGGAAGGGGGAGAAGGG + Intergenic
1022670316 7:32449399-32449421 GGGAACGGGAAGGGGAAGAAGGG + Intergenic
1022972848 7:35533063-35533085 CGGAGCTGCAAAGAAGAGAACGG + Intergenic
1023114237 7:36845789-36845811 GTGCACTGCAATGAGGAGAGAGG - Intergenic
1023184724 7:37521344-37521366 AGGAAAAGCAAGGAAGAGAAGGG - Intergenic
1023189048 7:37559585-37559607 GGAAAGTGAAAGGAGGAGAAAGG - Intergenic
1023247585 7:38221858-38221880 GGAAACAGCAAGGTGGACAATGG - Intronic
1024212602 7:47218613-47218635 TGGAACTGGAAGGAGGAAAGAGG - Intergenic
1025118903 7:56282559-56282581 GTGGAAGGCAAGGAGGAGAAAGG + Intergenic
1026154997 7:67818888-67818910 GGGAAGTGGAGGGAGAAGAAAGG - Intergenic
1026391370 7:69905859-69905881 AGGAACTGCAATGAAAAGAATGG + Intronic
1026394613 7:69938659-69938681 GGGAAGTGCAATGAGCAGAGAGG + Intronic
1026521819 7:71124275-71124297 GGGAACAGAAAGGAGGGAAAGGG + Intergenic
1026768349 7:73174613-73174635 GGGATCTCCAAGGAGGGGCAGGG + Intergenic
1026806075 7:73430345-73430367 GGGCACTGCAGGGAAGGGAAGGG - Intergenic
1027044812 7:74984318-74984340 GGGATCTCCAAGGAGGGGCAGGG + Intronic
1027078824 7:75218038-75218060 GGGATCTCCAAGGAGGGGCAGGG - Intergenic
1028163167 7:87508789-87508811 GAGAGCTGCAAGGAGGAAGAAGG + Intronic
1028492836 7:91432693-91432715 GGGAAGTTGAAGCAGGAGAATGG - Intergenic
1029388042 7:100256599-100256621 GGGATCTCCAAGGAGGGGCAGGG - Intronic
1029546268 7:101212113-101212135 GGGGGCTGCAAGGATGCGAATGG + Intronic
1029590504 7:101503857-101503879 GGACTCTCCAAGGAGGAGAATGG - Intronic
1029611687 7:101629952-101629974 GGGAAGTGCTGAGAGGAGAAAGG - Intergenic
1029711099 7:102300446-102300468 GGGAGCTGGAAGGAGGGGACAGG + Intronic
1029923146 7:104287555-104287577 GGGAAGGGAAAGGAAGAGAAGGG - Intergenic
1030632074 7:111907032-111907054 GAGACCTTCAAGGAGGAGGAAGG + Intronic
1031134181 7:117868024-117868046 GAGATCTGAAAGGAGGAAAAGGG - Intronic
1031355482 7:120782223-120782245 AGGAACTGAAATGAAGAGAAGGG + Intergenic
1031690601 7:124782859-124782881 GGGAACAGCAAGGGGGAAATTGG - Intronic
1031909930 7:127505423-127505445 GGGAAGGGGAAGGGGGAGAAGGG - Intergenic
1032366904 7:131307997-131308019 GGGACCTGCTGGGAGGTGAATGG + Intronic
1032482594 7:132258586-132258608 GGGGACAGGAAGGAGGAGAGTGG - Intronic
1032826558 7:135575404-135575426 GGGAACAGAAAGGAGTAGAGTGG + Intronic
1033174510 7:139112073-139112095 GGGAAAGGAAAGGAAGAGAAAGG + Intergenic
1033460051 7:141538723-141538745 TGGGAATGCAAGGAGAAGAAAGG + Intergenic
1033817161 7:145086331-145086353 TGTAACTGTAAGGAGGAAAACGG - Intergenic
1033825747 7:145187086-145187108 GGGAAGGGAAGGGAGGAGAAAGG - Intergenic
1033922091 7:146406632-146406654 GAGAACAGCCAGGAGGACAAAGG + Intronic
1034339094 7:150340962-150340984 GGGGACGGCAGGGAGGAGAGTGG - Exonic
1034441716 7:151089009-151089031 GGGAACAGCAGGGCTGAGAACGG - Intronic
1034521670 7:151625366-151625388 GGGAAATGCAGGGAGGAAAGAGG + Intronic
1034557107 7:151857258-151857280 GGGAGCTGGCAGGAGCAGAAAGG - Intronic
1034567699 7:151928885-151928907 GGGAGCTGCTAGGAGGTGATGGG - Intergenic
1035358754 7:158296019-158296041 GGGAAGTGCTGGGTGGAGAAGGG + Intronic
1035636114 8:1145508-1145530 GAGAAGTGGAAGGAGGAGAGGGG - Intergenic
1035838273 8:2782023-2782045 GGGAACTGTGAGGAGGAAAAGGG + Intergenic
1037071581 8:14656638-14656660 GGGAAATGAAAGGAGAGGAAAGG - Intronic
1037111487 8:15168604-15168626 GGTATCTGCTAGGAAGAGAAGGG + Intronic
1038059127 8:23892736-23892758 AGGAACTTGAAGGAGGAGCATGG + Intergenic
1038708416 8:29919049-29919071 GGGAACTGCAAAAGGGAGGAGGG + Intergenic
1039390080 8:37172256-37172278 GGGAAGTGCTGGGAGGAGAAGGG - Intergenic
1040498206 8:47984962-47984984 GGGAGCAGGAAGGAGGAGGAGGG + Intergenic
1040710515 8:50183080-50183102 AGGAAAAGCAAGGAGGAGCAAGG - Intronic
1041732509 8:61076891-61076913 GGGACTTGCAGGGAGGAAAAGGG - Intronic
1042045086 8:64641884-64641906 GGAAACTGGAAGGAAGACAATGG + Intronic
1042415095 8:68509727-68509749 GGTATCTGCTAGGAAGAGAAGGG - Intronic
1042867044 8:73365502-73365524 GGGAACTGCAGGGAGGACAACGG - Intergenic
1043423263 8:80122246-80122268 GGGAACTGGAAGTTGGATAAAGG + Intronic
1045063333 8:98426530-98426552 GGGAAGTCCAAGGTGGAGATCGG - Intronic
1045269206 8:100647845-100647867 GGGATCTCAAAGGAAGAGAAAGG - Intronic
1045494948 8:102700293-102700315 GGGAAATGCCAGGAGAAGGAAGG + Intergenic
1045698391 8:104836947-104836969 GGCAGCAGCAAGGAGAAGAATGG - Intronic
1045942433 8:107755018-107755040 GGGAAGTGCTGGGAAGAGAAGGG + Intergenic
1046260822 8:111765660-111765682 GGGAAGTGCTGGGAGGAGAAAGG + Intergenic
1046482270 8:114837613-114837635 GAGAACTCCAAGGAAGAAAAAGG + Intergenic
1047192606 8:122691779-122691801 TGGAACTCCAAGGATGTGAAAGG + Intergenic
1047438845 8:124858493-124858515 AGGGACTGAAAGGAGGACAAAGG - Intergenic
1047724542 8:127672411-127672433 GAGAAAAGCAAGGTGGAGAAGGG - Intergenic
1048473758 8:134725042-134725064 GAGATCTGCAAAGAGGAGCAGGG - Intergenic
1048541437 8:135345578-135345600 GTCAAGTGCAAGGAGGAGAAAGG + Intergenic
1048623452 8:136159480-136159502 GGGAAGTGCTGGGTGGAGAAGGG - Intergenic
1048671785 8:136730644-136730666 GGGAAGTGCTGGGAGGAGATGGG - Intergenic
1048862953 8:138737232-138737254 GGGAAGTGCTGGGAGGCGAAGGG - Intronic
1048923883 8:139253601-139253623 GAGAATTGCAAGCAGGAGAGAGG - Intergenic
1049386546 8:142345636-142345658 GGGAGCTGCAGGGAGGAGGCTGG - Intronic
1049428379 8:142547849-142547871 GAGAACTGCAGGGCTGAGAATGG + Intergenic
1049635326 8:143685090-143685112 GGGAATGGCAAGGAGGCAAATGG - Intronic
1050764565 9:9116061-9116083 GGTGACTGGAAGGAGGGGAAGGG + Intronic
1051288586 9:15522281-15522303 GTGAACTTCTAGGAGGAGGAAGG - Intergenic
1052355844 9:27503967-27503989 GGGGAATGAAAGCAGGAGAACGG - Intronic
1052370064 9:27654747-27654769 AGGAAGTGCTGGGAGGAGAAGGG + Intergenic
1052711089 9:32056499-32056521 GGCAAGTGCCAGGTGGAGAAGGG + Intergenic
1053103664 9:35392403-35392425 GGGAAGTGGAGAGAGGAGAATGG + Intronic
1053134530 9:35641979-35642001 GGGAACTAGAATTAGGAGAAGGG - Intronic
1053266348 9:36717065-36717087 GGGACCTGAGAGGAGGTGAAGGG - Intergenic
1054906943 9:70420385-70420407 GGGAACTGGAAGAAGGGGAGGGG - Intergenic
1054912416 9:70466325-70466347 GGGAAGTGCTGGGAGGAGAAGGG - Intergenic
1055082138 9:72277899-72277921 GGGAACTGGAAGAATGAGCAGGG + Intergenic
1055409909 9:76018045-76018067 TGAAACTGCAAAGGGGAGAACGG + Intronic
1055599752 9:77903432-77903454 AGGGACTGTAAGGAGGAAAATGG + Intronic
1055868271 9:80842093-80842115 GGGAAATGGCAGGAGGAGACAGG - Intergenic
1055933508 9:81583843-81583865 GTGAACTGCAAGGAACAGAAAGG + Exonic
1056303629 9:85268210-85268232 AGGAAATGAAAGGAGTAGAAGGG - Intergenic
1056573324 9:87834935-87834957 GGGAAATGCTGGGAGGAAAAGGG - Intergenic
1057782465 9:98061089-98061111 GGGAACAGAAAGGATGAGCAAGG - Intronic
1058586026 9:106507092-106507114 GGGAAGTAAAAGGAAGAGAAAGG + Intergenic
1058714496 9:107711556-107711578 GGGAACTGCGTGTAGGGGAAAGG - Intergenic
1058793261 9:108472095-108472117 GGGAATGGGAATGAGGAGAAAGG - Intergenic
1058828786 9:108797266-108797288 GGGAAGGGAAAGGAGGAGATGGG - Intergenic
1059435871 9:114275889-114275911 GCAAACTGCCAGGTGGAGAAAGG - Intronic
1059883222 9:118715493-118715515 GGGAAGGGAAAGGAAGAGAAGGG - Intergenic
1060770966 9:126332069-126332091 GGGAACTGCAAGGAGCAGATGGG - Intronic
1060781165 9:126414389-126414411 CGGAACTGCCCGGAGGAGACAGG - Intronic
1061651269 9:132052119-132052141 GGGAACACCAAGGGGGAAAACGG + Intronic
1062097860 9:134712113-134712135 GGGAACAGGAAGGAGGGGGAAGG - Intronic
1062236752 9:135513931-135513953 GGGGAATGCGAGGAGGGGAATGG + Intergenic
1062290940 9:135794054-135794076 AGCACCTGCAGGGAGGAGAAGGG + Intergenic
1203386777 Un_KI270438v1:62592-62614 TGGAATTGAAAGGAGTAGAATGG + Intergenic
1203678683 Un_KI270756v1:45189-45211 TGGAATTGAAAGGAGTAGAAAGG - Intergenic
1185552314 X:992968-992990 GGGAAGGGTAAGGAAGAGAAGGG + Intergenic
1185581298 X:1213091-1213113 GGGAAGTGAAAGGAAGGGAAGGG - Intergenic
1186372595 X:8962556-8962578 GGGAACTCCAAAAGGGAGAAGGG + Intergenic
1188763225 X:34057601-34057623 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
1188831483 X:34903156-34903178 GAGAAATGCAAACAGGAGAATGG + Intergenic
1189338123 X:40183230-40183252 TGGTAGTGCAAGGAAGAGAATGG - Intergenic
1189414345 X:40801590-40801612 GGGAAAGGAAAGGAGGAGATAGG + Intergenic
1189474071 X:41335170-41335192 GGGGCAAGCAAGGAGGAGAAAGG - Intronic
1189723690 X:43947275-43947297 GGGAATAGCAAGGCTGAGAAAGG - Intergenic
1189856981 X:45233400-45233422 GGGAACTGCTGGGAGGTGACTGG + Intergenic
1190927139 X:54920691-54920713 GGGAGCTACATTGAGGAGAATGG + Intronic
1191735393 X:64383746-64383768 GGGAACTGGTAGGAGGTGATTGG - Intronic
1191849354 X:65574614-65574636 GGGTGCTGCAAGGGGAAGAAGGG - Intergenic
1192000077 X:67140494-67140516 GAGAATGGAAAGGAGGAGAATGG - Intergenic
1192098607 X:68239513-68239535 GGCAAGTGCTAGGAAGAGAAAGG - Intronic
1192156946 X:68753695-68753717 GGGGCCTGCAAGGAGGAGGGGGG + Intergenic
1193836413 X:86349545-86349567 GGGAAGTGCTGGGAGGAGAAGGG - Intronic
1193945090 X:87724661-87724683 GGTATCTACCAGGAGGAGAAGGG - Intergenic
1194066379 X:89267094-89267116 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1194221551 X:91199985-91200007 GGGAAGTGCCAGGTAGAGAAAGG + Intergenic
1194715055 X:97278248-97278270 GGAAACTGAAAGGTAGAGAAGGG - Intronic
1196909832 X:120474115-120474137 GGGACATGCCAGAAGGAGAAAGG - Intergenic
1197127434 X:122963953-122963975 TGGAATAGCAAGGAGAAGAATGG + Intergenic
1197189763 X:123633256-123633278 GGGGACTGCAAGGTGGAAAATGG - Intronic
1197546259 X:127828263-127828285 GGGAACTTGAAGGAGGAGAAAGG - Intergenic
1198274332 X:135087201-135087223 GGGAAGTGGAAAGAGGAGTATGG + Intergenic
1198497022 X:137203401-137203423 GGGAACTGATAGGAGGTGACTGG - Intergenic
1198942116 X:141967034-141967056 GTGGAAGGCAAGGAGGAGAAAGG - Intergenic
1199234181 X:145471749-145471771 GGTATCTGCTAGGAAGAGAAGGG + Intergenic
1199891103 X:152083027-152083049 GGGGACTACAAGAAGGGGAAGGG + Intergenic
1200558063 Y:4663741-4663763 GGGAAGTGCCAGGTAGAGAAAGG + Intergenic
1200720548 Y:6601215-6601237 GGTATCTGCTAGGAAGAGAAGGG - Intergenic
1200951789 Y:8905004-8905026 GGGAAGTGGAAGTAGGAGGATGG + Intergenic
1201203016 Y:11557701-11557723 TGGAACAGAAAGGAAGAGAATGG + Intergenic
1201204319 Y:11568910-11568932 TGGAACAGAAAGGAAGAGAATGG + Intergenic
1201204968 Y:11574512-11574534 TGGAACAGAAAGGAAGAGAATGG + Intergenic
1201205619 Y:11580118-11580140 TGGAACAGAAAGGAAGAGAATGG + Intergenic
1201206267 Y:11585725-11585747 TGGAACAGAAAGGAAGAGAATGG + Intergenic
1201206916 Y:11591327-11591349 TGGAACAGAAAGGAAGAGAATGG + Intergenic
1201546119 Y:15163921-15163943 GGGAAGGGAAAGGAAGAGAAGGG + Intergenic
1202161169 Y:21938323-21938345 GGGAAGTGCAGGTAGGAGGATGG - Intergenic
1202230187 Y:22648050-22648072 GGGAAGTGCAGGTAGGAGGATGG + Intergenic
1202259077 Y:22950688-22950710 GGAAATTGCTAGGAAGAGAAAGG - Intergenic
1202312969 Y:23548115-23548137 GGGAAGTGCAGGTAGGAGGATGG - Intergenic
1202412063 Y:24584432-24584454 GGAAATTGCTAGGAAGAGAAAGG - Intergenic
1202458717 Y:25085636-25085658 GGTAATTGCTAGGAAGAGAAAGG + Intergenic
1202557833 Y:26122479-26122501 GGGAAGTGCAGGTAGGAGGATGG + Intergenic