ID: 1148775920

View in Genome Browser
Species Human (GRCh38)
Location 17:50095697-50095719
Sequence ATGGGGAAGCAGGAACCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148775910_1148775920 27 Left 1148775910 17:50095647-50095669 CCGAGTGACAGAGAAGGGTTGTT 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG 0: 1
1: 0
2: 0
3: 14
4: 219
1148775908_1148775920 29 Left 1148775908 17:50095645-50095667 CCCCGAGTGACAGAGAAGGGTTG 0: 1
1: 0
2: 2
3: 8
4: 105
Right 1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG 0: 1
1: 0
2: 0
3: 14
4: 219
1148775909_1148775920 28 Left 1148775909 17:50095646-50095668 CCCGAGTGACAGAGAAGGGTTGT 0: 1
1: 0
2: 3
3: 55
4: 727
Right 1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG 0: 1
1: 0
2: 0
3: 14
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148775920 Original CRISPR ATGGGGAAGCAGGAACCGGC CGG Intronic
901513446 1:9729894-9729916 CTGGGGAGGGAGGACCCGGCGGG + Exonic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
904475133 1:30760014-30760036 ATCGGGGAGCAGGGACGGGCTGG - Intergenic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907628845 1:56060031-56060053 AGGGGGTAGCAGGAACAGGATGG + Intergenic
907757010 1:57320195-57320217 AAGGGGAAGCAGGCACCTTCTGG - Intronic
910445372 1:87294586-87294608 ACACGGAAGCAGGAGCCGGCAGG + Intergenic
913061318 1:115211094-115211116 ATGTGGAAGCAGGGGCCAGCAGG - Intergenic
918540462 1:185626528-185626550 ATGGGGGAGCAGGTACCAGGTGG - Intergenic
921203930 1:212831950-212831972 ATGGGGAAACAGAAAACAGCAGG - Intronic
922809270 1:228406832-228406854 AGGCGGAAGCAGGAAGCGACTGG + Exonic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1069718477 10:70535433-70535455 AGGGGGAAGGAGGAAGCGGGGGG - Intronic
1070124031 10:73605828-73605850 TTGGGGAAGGAGGAATCGGGGGG + Intronic
1070165500 10:73894608-73894630 ATGGGGCAACAGGAAGCAGCTGG + Intergenic
1070980443 10:80641445-80641467 ATGGGGAAGCTCGAACTGGGTGG - Intronic
1071718484 10:88120112-88120134 AGGGGGAAGCAGGAACGAGGGGG + Intergenic
1071718499 10:88120165-88120187 AGGGGGAAGCAGGAACGAGGGGG + Intergenic
1072660675 10:97361645-97361667 GTGGAGAAACAGGAACCGGGAGG + Intronic
1073037778 10:100576180-100576202 GTGGTGAAGCAGGAAACTGCTGG - Intergenic
1074272427 10:111967836-111967858 ATGGGGAACCAAGATCCAGCAGG - Intergenic
1077096648 11:801839-801861 ATAGGGAAGCAGGATCCAGGAGG + Intronic
1077198053 11:1291402-1291424 ACTGGGAAGGAGGAACTGGCGGG - Intronic
1077289574 11:1782656-1782678 ATTGGGTAGCAGGAAGGGGCAGG - Intergenic
1078466333 11:11553229-11553251 ATCTGGAAGCAGGAAGCGGTGGG - Intronic
1079329468 11:19521747-19521769 ATGAGGAAGCAGGAATCAGAGGG + Intronic
1081631438 11:44692637-44692659 AGGGGGAAGCAGGAGCCCCCGGG + Intergenic
1083723225 11:64614032-64614054 ATGAGGAGGCAAGAACTGGCTGG + Intronic
1084315186 11:68341701-68341723 CTGGGAAAGAAGGAGCCGGCAGG - Intronic
1085049218 11:73371372-73371394 ATGGGGAAAGAGGAAAAGGCAGG + Intergenic
1085259771 11:75197863-75197885 AAAGGGGAGGAGGAACCGGCTGG - Intronic
1086476084 11:87176267-87176289 ATGGGGAGACAGGAAGGGGCAGG - Intronic
1089615821 11:119694212-119694234 CAGGGGAAGCAGGAGCTGGCAGG + Intronic
1090251885 11:125257302-125257324 GAGGGGAAGCAGGAACCATCTGG + Intronic
1091157539 11:133387351-133387373 AGGAGGAAGCAGCCACCGGCGGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1102642479 12:114379230-114379252 AAGGGGAAGCAGGAAGCACCAGG - Intronic
1108187469 13:47902238-47902260 CTGGGGAAGAAGGAACCAGCAGG + Intergenic
1108407958 13:50124153-50124175 CTGGGGAAGGAGGAGCCGGCGGG + Intronic
1109611492 13:64771145-64771167 ATGGTGAAGCAGGAGCTTGCAGG - Intergenic
1113841748 13:113364702-113364724 TTGGGGGGGCAGGAACGGGCGGG - Intergenic
1114779506 14:25522324-25522346 GTGGAGAAGCCGGAACCGCCTGG - Intergenic
1119693087 14:76692041-76692063 AAGCGGAGGCAGGAACCGGCAGG + Intergenic
1122091130 14:99341303-99341325 ATGGGGAAAGAAGCACCGGCTGG + Intergenic
1122236270 14:100332304-100332326 GTGGGGAAGCAGGGACAGGAAGG - Intergenic
1122634900 14:103125231-103125253 AGGGGGAAGCAGGCAGGGGCTGG - Intronic
1122657654 14:103273258-103273280 ACGCGGAAGCTGGAAGCGGCGGG - Intergenic
1122792851 14:104191669-104191691 AACGGGAGGCAGGAACTGGCAGG - Intergenic
1122949470 14:105033718-105033740 AAGGGGAAGGAGGAACAGGGTGG - Intergenic
1123710215 15:22980869-22980891 ATGGGGCCGCAGGGGCCGGCCGG - Intronic
1124899941 15:33813018-33813040 ATGGGGAAGCAGAAACACCCTGG + Intronic
1124937450 15:34186433-34186455 TTGGGGAGCCAGGAACAGGCAGG + Intronic
1125589074 15:40843738-40843760 CTGGGAAAGCAGGCCCCGGCCGG + Intergenic
1126016404 15:44355466-44355488 ATGGTGAAGCAGGCATCGGAAGG + Intronic
1128811482 15:70576119-70576141 ATGGGGAAGCAGGAAAGAGTTGG + Intergenic
1129056076 15:72821532-72821554 AAGGGGAAACAGGAACCAGGAGG - Intergenic
1131732767 15:95299493-95299515 ATGAGGTATCAGGAACTGGCTGG + Intergenic
1132176634 15:99721153-99721175 ATGGGGAAGCATTGACCTGCAGG + Intronic
1132481790 16:169951-169973 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132482658 16:174208-174230 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132927064 16:2436287-2436309 AACGGGAAGCAGGTACAGGCAGG + Intronic
1135205572 16:20480925-20480947 ATGGGGAAGCAGTAGCCTGGGGG + Intronic
1135213335 16:20542888-20542910 ATGGGGAAGCAGTAGCCTGGGGG - Intronic
1138928142 16:61617311-61617333 TTGAGGATTCAGGAACCGGCTGG + Intergenic
1140194426 16:72845055-72845077 ACGGAGGAGCAGGAACCTGCCGG - Intronic
1141108135 16:81250302-81250324 ATGGGGAGGCAGGAGCTGGTGGG - Intronic
1141604611 16:85145723-85145745 ATGGGGACGGAGGAGCCGACGGG + Intergenic
1142704139 17:1683793-1683815 AGGGAGAAGCAGGCACCAGCAGG + Intronic
1143289961 17:5820965-5820987 TGGGGGAAGCAGGAATCGGGAGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1143785619 17:9253532-9253554 ATGAGGAGGCAGGCACAGGCTGG + Intronic
1143875100 17:9985456-9985478 ATGGGGGAGCAGGAGGCGGCAGG - Intronic
1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG + Intronic
1149467586 17:56891984-56892006 CTACGGAAGCATGAACCGGCAGG - Exonic
1151365247 17:73612535-73612557 ATGGGGAAGCCGGGACCCTCAGG - Intronic
1151732072 17:75917593-75917615 ATGTAGAGGCAGGAAGCGGCAGG + Intronic
1151842645 17:76628796-76628818 ATGGGGGAGGAGGAGCAGGCAGG - Intronic
1152327447 17:79649873-79649895 ATGGTGGAGCAGGAACAAGCAGG + Intergenic
1153227327 18:2908741-2908763 GTGAGGAAGCAGGGACGGGCTGG + Intronic
1153828454 18:8898698-8898720 ATGGGGAAGCGGCAACCTGGGGG - Intergenic
1157833558 18:50879016-50879038 AATTGGAGGCAGGAACCGGCCGG - Intergenic
1159960410 18:74551141-74551163 AAGGTGAAGCAGGAACAGGCAGG - Intronic
1160929991 19:1566123-1566145 ATGGGGAGGCAGTAACAGGATGG + Intronic
1161719162 19:5893846-5893868 CGGGGACAGCAGGAACCGGCAGG - Intronic
1163430166 19:17262694-17262716 CTTGGGAAGCAGGAAGGGGCAGG - Exonic
1163545042 19:17936368-17936390 ATGGGGGAGCAGGGGCCGGAGGG - Intronic
1164210434 19:23093512-23093534 GGGGGGAAGCAGGAACCAGAGGG - Intronic
1165325381 19:35111619-35111641 ACAGGGAAGCAGGAAAGGGCAGG - Intergenic
1165433977 19:35786953-35786975 ATGGGGGCGCAGGCTCCGGCCGG - Exonic
1165827348 19:38712872-38712894 TTGGGGGAGCAGGGACTGGCAGG + Intronic
1166088398 19:40492143-40492165 ATGGGGAAGCAACAAGGGGCAGG + Intronic
1166499729 19:43331604-43331626 AAGGGGAAGCAGGAACCAGAAGG - Intergenic
1167033364 19:46978325-46978347 ATTGGGAATCAGGAACCTGAAGG + Intronic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168124522 19:54276179-54276201 ATGGGGAAAGGGGCACCGGCTGG - Intronic
1168329599 19:55559599-55559621 ATGGGGAAGCAGGGAGCTGGAGG + Intergenic
1168645398 19:58056145-58056167 ATGGGGCAGAGGGAACGGGCTGG - Intergenic
927203420 2:20592340-20592362 AAGGGGAAGTAGGAATGGGCGGG - Intronic
932468274 2:71937813-71937835 AGGGGGAAGCAGGAACCCTGTGG - Intergenic
939466284 2:142561660-142561682 AGTGGGAACCAGGAACCGGAGGG + Intergenic
940859594 2:158758147-158758169 TTGAGGCAGCAGGAACCAGCCGG - Intergenic
942516944 2:176764219-176764241 TTGGTGAGGCAGGAACCAGCAGG + Intergenic
942679166 2:178458793-178458815 ATGGGGAAGCAGCGAACGGAGGG - Intronic
943743188 2:191433435-191433457 ATGTGGAAGCCGAAACTGGCAGG + Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944700236 2:202239493-202239515 ATGGGGAAGCAGGCTCTGACCGG + Intergenic
946408735 2:219506194-219506216 AGGAGGCAGCAGGAACCGGAGGG - Intronic
947723283 2:232381805-232381827 ATGGGGAAGCAGGAGCCCCAGGG - Exonic
947727627 2:232409882-232409904 ATGGGGAAGCAGGAGCCCCAGGG - Exonic
1168846673 20:949884-949906 AGGAGGAAGCAGGAGCCGCCAGG - Intergenic
1169473577 20:5910387-5910409 ATCGGGAAGCAGCAGCAGGCAGG - Intergenic
1169868446 20:10225755-10225777 ATGGGGAAGCTGGGACCAGATGG - Intronic
1170894930 20:20404299-20404321 ATGGGCAAAAAGGAACCGGCAGG + Intronic
1171485671 20:25483844-25483866 ATGGGGAAGCATGCACAGCCTGG - Intronic
1172778304 20:37420669-37420691 ATGGGGAAGGAGGAGCAGGGAGG - Intergenic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1175484045 20:59332047-59332069 AAGGGGAAGCAGGTCCCTGCTGG + Intergenic
1176025198 20:62982119-62982141 AGGAGGCAGCAGGAACAGGCTGG + Intergenic
1176517568 21:7797490-7797512 ATAGGGAAGCAGGCAGCTGCAGG - Intergenic
1178651596 21:34427502-34427524 ATAGGGAAGCAGGCAGCTGCAGG - Intergenic
1179725623 21:43339894-43339916 CTCGGGAAGCAGGAAAAGGCAGG + Intergenic
1179908221 21:44435069-44435091 ATGGGGGAGCAGGACAGGGCAGG - Intronic
1180068833 21:45426016-45426038 GTGGGGAAGCAGGAGGGGGCGGG - Intronic
1181967315 22:26666348-26666370 ATGGGGCATCAGGAAAGGGCAGG + Intergenic
1182080033 22:27522358-27522380 AAGATGAAGCAGGAACCAGCTGG + Intergenic
1183061337 22:35338113-35338135 GTGGGGAGGCAGGAACTGGGAGG - Intronic
1183081302 22:35458399-35458421 ATGGGGGTGCAGGTGCCGGCGGG + Intergenic
1183349465 22:37326798-37326820 ATGGGGAGGCAGCAAGCAGCAGG - Intergenic
1183538683 22:38417451-38417473 ATGGGGCAGCAGGAATAGGGGGG - Intergenic
1184426097 22:44410150-44410172 ATGGGTTAGCAGGAACCAGGTGG - Intergenic
1184480513 22:44744176-44744198 ATGAGGATGCAGGATCAGGCGGG + Intronic
1184500825 22:44870524-44870546 GTGGGGAAGAAGGAGCCGGGAGG - Intergenic
1184884727 22:47335797-47335819 GTGGGAAAGCAAGAACAGGCTGG - Intergenic
1185047058 22:48533841-48533863 ATGGGGAAGCAGCAGCCGTGTGG + Intronic
1185164616 22:49253737-49253759 ATGAGGGAGCAGGAAACTGCAGG + Intergenic
952698710 3:36302658-36302680 ATGGGGAAGAAGGCAAAGGCTGG + Intergenic
954635203 3:52067387-52067409 ATGGGTGAGCAGGAGCCAGCGGG - Intergenic
955131474 3:56173600-56173622 AAGGGGAACCAGGACCCAGCAGG - Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955645908 3:61137193-61137215 ATGGGGAAGAAGGAAGGAGCAGG - Intronic
959502066 3:107118179-107118201 ATGGGGAAGCAGCAGTTGGCAGG - Intergenic
961457131 3:127029803-127029825 ATGGGGAAACAGGCTCGGGCGGG + Intronic
961722912 3:128908085-128908107 ATGGGCAAGCAGGCAGTGGCCGG + Intronic
962143575 3:132816890-132816912 TTGGGGAACCAGGAACAGGCTGG + Intergenic
962594389 3:136925515-136925537 ACGGGGCAGCAGGAACAGGAGGG - Intronic
963435197 3:145258133-145258155 GTGGGGAAGCTGGAACTGGGTGG - Intergenic
965615339 3:170586350-170586372 CTGGGAAAGCAGGGACCAGCAGG + Intronic
967969843 3:194990860-194990882 ATGGGGATGATGGAAACGGCAGG + Intergenic
968467857 4:761880-761902 ATGGGGATGCAGGCGCCAGCAGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969226494 4:5801866-5801888 ATGGGGAGGCAGGGACTGGATGG + Intronic
969247308 4:5944152-5944174 ATGGGGAGGGAGGAACCAGGAGG - Intronic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
975050104 4:69852474-69852496 ATGGGGAAGAAGGAAGAAGCGGG - Intronic
975885892 4:78964226-78964248 ATTGGGAAGCAGTGACCAGCAGG + Intergenic
977126116 4:93170538-93170560 ATGGCGAAGCAGGAACTGTCTGG - Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
981043279 4:140242869-140242891 ATGGGGAAGAAGGGAAGGGCAGG + Intergenic
983524709 4:168749178-168749200 AAGGTGAAGCAGGAGCAGGCAGG - Intronic
983996866 4:174192851-174192873 ATGGGGAAGCTGAAACCGAGTGG - Intergenic
984555638 4:181211203-181211225 ATGGGGAAGCAGGTGCTGGTAGG + Intergenic
984864054 4:184266139-184266161 GTGAGGAATCAGGAACAGGCTGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991920648 5:71653361-71653383 ATGTGAAAGCAGGCACCAGCAGG - Intronic
995853635 5:116572667-116572689 ATGGGGAAGCAGGACCCCGGAGG - Intronic
998901723 5:146862585-146862607 AAGGGGAAGCAGGAATGGCCTGG + Intronic
1000033627 5:157424818-157424840 ATTGGGAAGCTGGAACTGGGTGG + Intronic
1000092671 5:157943555-157943577 ATGGCCAAGCAGGAACTGGCAGG - Intergenic
1000953998 5:167520753-167520775 ATGAGGAAGCAGGAATAGGGAGG - Intronic
1004364389 6:14999621-14999643 ATGGGGAAGCGGGAAGGGCCTGG - Intergenic
1005069111 6:21848264-21848286 ATCTGGAAGCAGGAACCGATGGG + Intergenic
1012989241 6:105908169-105908191 ATGAGGAAGCAGGAATAGGCGGG - Intergenic
1015974294 6:138773702-138773724 CTGGGGGAGCAGGAAAAGGCGGG + Exonic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1017755501 6:157525856-157525878 ATGGGGAAGGTGGAAGCAGCTGG - Intronic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1018479783 6:164178827-164178849 AAAGGGAAGCTGGACCCGGCAGG - Intergenic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1024676027 7:51638558-51638580 ATGGGGCAGCTGGAACTGCCAGG - Intergenic
1024995379 7:55270101-55270123 CTGGGGAAGCCGGAGGCGGCTGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026839861 7:73664359-73664381 ATGTGGAGACAGGAACTGGCAGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1029184201 7:98727012-98727034 ATGGGGAGGCAGGTGCAGGCAGG + Intergenic
1029320177 7:99751925-99751947 TTGGGGGAGCAGGAACCACCAGG + Intergenic
1029733386 7:102452068-102452090 GTGGGGCAGCAGGAACAGGTGGG + Exonic
1030102223 7:105956533-105956555 AGGGGGAAGAAGGAATCAGCTGG + Intronic
1031946314 7:127844964-127844986 TTGGGGAAGCAGGGCCCAGCAGG - Intronic
1032000340 7:128261076-128261098 GTGGGCAAGCAGAAAACGGCTGG - Intergenic
1032013244 7:128360258-128360280 AGGGGGAAGGAGGAACCCCCAGG - Intronic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1034643747 7:152625924-152625946 ATGGGGAAGCAGGAACAAGGGGG + Intergenic
1036619653 8:10416077-10416099 CTGGGGAAGCAGGCTCAGGCAGG - Intronic
1037959250 8:23084070-23084092 ATGGGGATGCAGGAAAGGCCGGG - Intergenic
1038151987 8:24950296-24950318 AAGGGTCAGTAGGAACCGGCTGG + Intergenic
1040387157 8:46921322-46921344 CAGGGGAAGGAGGAACAGGCTGG + Intergenic
1042105066 8:65317396-65317418 AAGGGGAAGCAGGTACAGGCAGG + Intergenic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1044506314 8:93024204-93024226 GTGGGGAAGCAGGAGTAGGCAGG + Intergenic
1046195607 8:110860001-110860023 AGGGGGAGCCAGGAACAGGCGGG + Intergenic
1046770502 8:118112176-118112198 CCGGGGAAGGAGGCACCGGCAGG + Intergenic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049052969 8:140213705-140213727 AAGGGGGAGCAGGAACCAACAGG + Intronic
1049206186 8:141364748-141364770 ATGGGGAGGCAGGGAGGGGCTGG - Intronic
1049501962 8:142971700-142971722 GTGGGGCAGCAGGAACCTGGTGG + Intergenic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051804207 9:20973592-20973614 ATGGGGAAGCAAGAGTCAGCAGG - Intronic
1051804224 9:20973784-20973806 ATGGGGAAGCAAGAGTCAGCAGG - Intronic
1051804243 9:20973976-20973998 ATGGGGAAGCAAGAGTCAGCAGG - Intronic
1051804262 9:20974168-20974190 ATGGGGAAGCAAGAGTCAGCAGG - Intronic
1051804280 9:20974360-20974382 ATGGGGAAGCAAGAGTCAGCAGG - Intronic
1051804300 9:20974552-20974574 ATGGGGAAGCAAGAGTCAGCAGG - Intronic
1051804319 9:20974744-20974766 ATGGGGAAGCAAGAGTCAGCAGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1057564993 9:96159855-96159877 ATGGGAAAGCAGGATACAGCAGG + Intergenic
1058551988 9:106124523-106124545 GTGGGGAAGCAGGAACATTCAGG + Intergenic
1061958073 9:133973935-133973957 ACGTGGAAGCAGGATCCAGCAGG + Intronic
1062627453 9:137449713-137449735 ATGGGGAAGGAGGAGCGGGGAGG + Intronic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1189333227 X:40155445-40155467 GTGGGGAAGCAGGAAGGGGGTGG + Intronic
1190236075 X:48616768-48616790 AGGAGGAAGCAGGATCGGGCAGG + Intergenic
1190630570 X:52381480-52381502 GTGGGGAACCAGGAAGGGGCAGG + Intergenic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1192696137 X:73417892-73417914 ATGGGGTAGCAGGCAGAGGCTGG - Intergenic
1194954179 X:100160407-100160429 ATGGGAAAGCAGAAAAGGGCAGG - Intergenic
1199482309 X:148311180-148311202 ATGGGAAAGCAGAAAGCCGCAGG + Intergenic