ID: 1148776013

View in Genome Browser
Species Human (GRCh38)
Location 17:50096074-50096096
Sequence CTCTTTCAGAAGATGCCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148775998_1148776013 25 Left 1148775998 17:50096026-50096048 CCCCTGGGCAGAGGGTGAGATTA 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1148776013 17:50096074-50096096 CTCTTTCAGAAGATGCCATTGGG 0: 1
1: 0
2: 0
3: 23
4: 259
1148776000_1148776013 23 Left 1148776000 17:50096028-50096050 CCTGGGCAGAGGGTGAGATTAAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1148776013 17:50096074-50096096 CTCTTTCAGAAGATGCCATTGGG 0: 1
1: 0
2: 0
3: 23
4: 259
1148776010_1148776013 0 Left 1148776010 17:50096051-50096073 CCAGGGGCAGTTGGGGAAGGGGG 0: 1
1: 1
2: 8
3: 96
4: 885
Right 1148776013 17:50096074-50096096 CTCTTTCAGAAGATGCCATTGGG 0: 1
1: 0
2: 0
3: 23
4: 259
1148775999_1148776013 24 Left 1148775999 17:50096027-50096049 CCCTGGGCAGAGGGTGAGATTAA 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1148776013 17:50096074-50096096 CTCTTTCAGAAGATGCCATTGGG 0: 1
1: 0
2: 0
3: 23
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148776013 Original CRISPR CTCTTTCAGAAGATGCCATT GGG Intronic
900009296 1:91271-91293 AACTTTGAGAAGATGCCCTTGGG - Intergenic
900025413 1:267850-267872 AACTTTGAGAAGATGCCCTTGGG - Intergenic
900029015 1:357232-357254 AACTTTGAGAAGATGCCCTTGGG - Intergenic
900049617 1:586004-586026 AACTTTGAGAAGATGCCCTTGGG - Intergenic
901259871 1:7863614-7863636 TTCATTCAGTAAATGCCATTTGG - Intergenic
904725198 1:32541449-32541471 CTCATTGAGAAGATGGCATTTGG - Intronic
905504608 1:38467206-38467228 CTATTTGAGAAGGTGACATTTGG - Intergenic
905590293 1:39157450-39157472 CTGGCTCACAAGATGCCATTGGG - Intronic
905771097 1:40638549-40638571 CCATTCCAGAAGATGCCATAGGG - Intronic
908154531 1:61338942-61338964 TTCTTTCAAAAGAAACCATTTGG + Intronic
912237095 1:107864249-107864271 CTCTTTCAGTAGATCCCCTTGGG - Intronic
912782566 1:112565491-112565513 GTCTTACAGAAGAAGCCCTTAGG - Intronic
913133623 1:115865487-115865509 CTCTTTCAGAAGTTGTATTTAGG + Intergenic
918029716 1:180793961-180793983 TTGTTTGTGAAGATGCCATTTGG - Intronic
919936707 1:202255915-202255937 CTCTTTTAAAATATGCAATTCGG + Intronic
920162697 1:204011502-204011524 CTCATTCAGAAAATGACCTTTGG + Intergenic
921334475 1:214072535-214072557 CTCTTTAAAAAAATGCCATCTGG + Intergenic
922534585 1:226370492-226370514 GACCTTCAGAAGATGCCCTTGGG - Exonic
924196965 1:241618264-241618286 CTATTTCAAAAGCTGGCATTTGG - Intronic
924622842 1:245677520-245677542 CTCCTTCTGAAAATGCCATCAGG + Intronic
1063097968 10:2924851-2924873 CTCTATCAGAAGCTGCCATCTGG - Intergenic
1063244890 10:4207526-4207548 CTCTTTCAGAAGCTTCCTGTAGG - Intergenic
1064096161 10:12426113-12426135 CTCTTTCATGAGATGTCTTTGGG + Intronic
1064104832 10:12492138-12492160 CTCTTTGAGAGGATGACAGTGGG + Intronic
1065798312 10:29327746-29327768 TTCCTTTAGAAGATGCCATCAGG - Intergenic
1066314867 10:34234596-34234618 TTCTTTGGGAAGATGACATTTGG - Intronic
1067327444 10:45282907-45282929 CTCTTTCATAAGCTGCCACAGGG - Intergenic
1070296343 10:75164508-75164530 CTCTTACAGAAAATGATATTTGG - Intronic
1070657809 10:78283207-78283229 CACTTTCAGAAGATCCCAGCAGG - Intergenic
1071369264 10:84934708-84934730 CTATTTCAGAAGAAGCATTTGGG + Intergenic
1072243241 10:93517468-93517490 CTCTCTGAGGAGATGGCATTTGG + Intronic
1074238060 10:111606326-111606348 ATCTTCCAGAAGATGAAATTTGG + Intergenic
1076075358 10:127529888-127529910 CTCCTTCAGAGGCTGCCCTTGGG - Intergenic
1076451430 10:130559715-130559737 CTCTGCCAGCAGATGCCCTTTGG + Intergenic
1078594138 11:12672446-12672468 TGCTTTTAGAAGATGACATTTGG + Intergenic
1079030739 11:16984566-16984588 CTCTTTGTGGAGATGACATTTGG - Intronic
1079271282 11:18988293-18988315 CTTTTTCAGAAGATGTGGTTGGG - Intergenic
1079477640 11:20848218-20848240 CTCTTTAAGAAGCCTCCATTTGG - Intronic
1080390215 11:31838841-31838863 ATCTTTCAGTGTATGCCATTTGG - Intronic
1080479686 11:32633604-32633626 CTCTATTAGAAGATGACCTTTGG - Intronic
1081948594 11:47021903-47021925 AACTCTCAGAAGATGTCATTGGG - Intronic
1081953818 11:47071162-47071184 CTCTTTCATAAAATGCCATGTGG + Intronic
1082114262 11:48311046-48311068 CTATTGCACAAGATGTCATTGGG + Intergenic
1083268819 11:61560382-61560404 CTTTTGCAGAATATTCCATTTGG + Intronic
1084503020 11:69546028-69546050 GTCTTCCAGAGGATGGCATTGGG - Intergenic
1086138117 11:83463234-83463256 ATCTTTCAAAAGAGGCTATTTGG + Intronic
1086824151 11:91475150-91475172 CTCTTTCACCAGAAGCCACTGGG - Intergenic
1086891744 11:92266399-92266421 CTCTTTGATAAAATGTCATTAGG + Intergenic
1087090336 11:94264243-94264265 CTATTTCTGAAAATGCCACTGGG + Intergenic
1087843604 11:102945953-102945975 CTCTTTAAAAAGATGGCCTTTGG - Intronic
1088132900 11:106516759-106516781 CTCTTTCTGTAGATTCCATGGGG - Intergenic
1088874719 11:113925032-113925054 CTCTTTCAAATGATGCCACCTGG + Intronic
1088949075 11:114547098-114547120 CTCTTTCAAAAGAGGTCACTAGG - Intronic
1089295620 11:117465475-117465497 CTCGTTCAGAAGAGGCATTTCGG - Intronic
1089362453 11:117900089-117900111 ATCGTTCAGAAGAGGCCAGTGGG + Intergenic
1089675944 11:120089283-120089305 CACATTCAGACTATGCCATTTGG + Intergenic
1089841963 11:121426251-121426273 CTCTCTAAGAAGGTGACATTTGG - Intergenic
1089904993 11:122029555-122029577 TTCTTTCACAAGCTGCCTTTAGG + Intergenic
1090115672 11:123969789-123969811 ATTCTTCAGAAAATGCCATTGGG + Intergenic
1090506030 11:127315707-127315729 CTCTTTCAGAAGTTGTCAGTTGG + Intergenic
1092900256 12:13053050-13053072 TACTTTCAGAATATGCCATGGGG - Intronic
1093109103 12:15127754-15127776 TGCTTTTAGAAAATGCCATTAGG + Intronic
1093600278 12:21013280-21013302 TGTTTTGAGAAGATGCCATTGGG + Intergenic
1094212748 12:27909780-27909802 CATTTTAAGAAGATGGCATTTGG + Intergenic
1094430172 12:30359880-30359902 CTTTCTCAGAAGATGTGATTGGG - Intergenic
1095161615 12:38924067-38924089 GTCTTTCATTAAATGCCATTTGG + Intergenic
1095355885 12:41274681-41274703 CTTCTTCAGATGATTCCATTAGG + Intronic
1099921649 12:88965403-88965425 CTCTTTAAAAAGATTGCATTTGG + Intergenic
1101896038 12:108757618-108757640 ATCTTTTAGAAGATGCCACTGGG + Intergenic
1104370709 12:128221599-128221621 CTCTATCACAAGATGGCACTAGG - Intergenic
1104489337 12:129180656-129180678 CTTTTTGAGAAGGTGACATTTGG + Intronic
1106657248 13:31759349-31759371 CTTTTTAAGATGATGACATTTGG + Intronic
1107329155 13:39279655-39279677 CTCTTTTAGAGGTTTCCATTTGG + Intergenic
1109116583 13:58395840-58395862 CTGTTTCAAAACATGCCACTTGG - Intergenic
1110167355 13:72459770-72459792 CACTGTCAGAATAAGCCATTTGG + Intergenic
1110897635 13:80774989-80775011 CTCAGTCAGAAGATGTCATCTGG - Intergenic
1110982287 13:81916196-81916218 CCCTTTAAGATGATGCCATGTGG + Intergenic
1113961618 13:114129483-114129505 CTCATTCAGACGTTGACATTGGG - Intronic
1118463385 14:66008011-66008033 CTCTTTGAGGAGCTGACATTTGG - Intergenic
1120197232 14:81497699-81497721 CACTCTCAGGAGATTCCATTTGG - Intronic
1124415711 15:29471797-29471819 CTTTTTCAGAAGAAGGCATGAGG - Intronic
1126502818 15:49365863-49365885 CTAATTCATAAGATGCCATATGG - Intronic
1128369873 15:67032857-67032879 CTCTCTCACAAGCTGACATTGGG - Intergenic
1133315103 16:4878066-4878088 CTATTTCAGAAGATGCTAAGGGG - Intronic
1133461679 16:5991603-5991625 CTCATCGAAAAGATGCCATTTGG + Intergenic
1135923132 16:26669095-26669117 CTTTTTAAGAAGATGCAATTTGG - Intergenic
1136091005 16:27919962-27919984 CCCCTTCGGAACATGCCATTTGG - Intronic
1139290290 16:65852236-65852258 CTCTATCACGAGATGGCATTAGG + Intergenic
1140422454 16:74831803-74831825 ATTTTTCAGCAGAAGCCATTTGG + Intergenic
1142455027 16:90215628-90215650 AACTTTGAGAAGATGCCCTTGGG + Intergenic
1142872456 17:2829596-2829618 CTCTTTCATAACAAGCCCTTCGG - Intronic
1143073853 17:4322402-4322424 CTCTTCCCTAAGATGGCATTAGG + Intronic
1143418235 17:6766134-6766156 CTCCTTGAGAAGGTGCCATCTGG - Intronic
1144479995 17:15621378-15621400 TTCTTTGAGAAGATGACAATGGG + Intronic
1148776013 17:50096074-50096096 CTCTTTCAGAAGATGCCATTGGG + Intronic
1149205124 17:54234921-54234943 CACTGTGAGTAGATGCCATTAGG + Intergenic
1149368795 17:55971961-55971983 TTCTGGCAGAAGATTCCATTAGG - Intergenic
1149774645 17:59347737-59347759 CTCTTTGAGATGATACCACTGGG - Intronic
1152241885 17:79165231-79165253 CCCTTTCAGAAGATGACACAAGG - Intronic
1152950743 17:83229324-83229346 AACTTTGAGAAGATGCCCTTGGG + Intergenic
1154093430 18:11386745-11386767 CTCCTCCAGAAGAGGACATTTGG + Intergenic
1154246119 18:12701340-12701362 CCCTCTCAGAAGATTCCTTTTGG - Intronic
1155108568 18:22690983-22691005 CTCTTTCATAAGGTACCATTTGG - Intergenic
1156196514 18:34780042-34780064 TTCCTTCAGAAAATGACATTTGG - Intronic
1157700289 18:49758001-49758023 CTCTCTGTGAAGATGACATTTGG + Intergenic
1157990119 18:52485119-52485141 CTCTTTCATAACATGACATGTGG + Intronic
1158673789 18:59500570-59500592 CTCATTAAGAAGGTGCCATGGGG - Intronic
1159685788 18:71418317-71418339 CTCATTGAGAAGGTGACATTTGG + Intergenic
1162817134 19:13202771-13202793 CTCTTTAAGAAGGTGACATAAGG + Intergenic
1167781831 19:51603280-51603302 CTCTTTGAGAAGGTGACTTTGGG + Intergenic
925904335 2:8530331-8530353 CTCTTTCAGAGGGTGCCAGGAGG + Intergenic
926378488 2:12260147-12260169 CTTTTGCAGAAGATGGCATTTGG + Intergenic
926870825 2:17414329-17414351 CTCTTTTAGAAAATGTCATAAGG + Intergenic
927454509 2:23237990-23238012 CTCTTTCAGAACCTGTCACTCGG - Intergenic
928033783 2:27802902-27802924 CTGTTTGTGAACATGCCATTAGG + Intronic
929899957 2:45992387-45992409 CTCTTTCTGGTGATGACATTTGG + Intronic
931209027 2:60175089-60175111 CTCTTTGAGGAGATGACTTTAGG - Intergenic
931527842 2:63177269-63177291 ATATTTCCAAAGATGCCATTGGG + Intronic
931575368 2:63712866-63712888 CTCTTGGAGAAGATGACATCAGG - Intronic
931607374 2:64065749-64065771 CTCTTTCTTAAGATGTCATTCGG - Intergenic
931700452 2:64904838-64904860 CTCTTTCAGAAGAGCCCCTGTGG + Intergenic
933481329 2:82860726-82860748 CTCTTTTAGAACATTTCATTTGG + Intergenic
934936990 2:98472750-98472772 CTCTTACAGAAGAGGGCATTGGG + Intronic
936344381 2:111664075-111664097 CTGTTTCTGAAGATTCCTTTAGG + Intergenic
936926897 2:117746118-117746140 CTATTTCAGAAGATGGCTATGGG - Intergenic
937650522 2:124313921-124313943 CTAAGTCTGAAGATGCCATTAGG - Intronic
941245866 2:163096128-163096150 CACTTTTGGAAGATGCCTTTAGG - Intergenic
941599600 2:167525588-167525610 TTCTTTCAGATGTAGCCATTGGG + Intergenic
942214666 2:173706910-173706932 CCCATTCTGAAAATGCCATTGGG + Intergenic
942869240 2:180715060-180715082 CTCTTTCAGAAAATGTCACTTGG - Intergenic
943061525 2:183045690-183045712 CTCTTTAAGAAGAAATCATTGGG - Intergenic
944460516 2:199944807-199944829 CTCTATGAGAAGATGACCTTGGG + Intronic
944984122 2:205155226-205155248 CAGTTTCAGAATATGCCATGAGG + Intronic
945196732 2:207243785-207243807 CTCTCTCAAAAGAGGGCATTTGG + Intergenic
945604043 2:211905800-211905822 CTCTTTGAAAAGGTGGCATTTGG + Intronic
946186049 2:217980919-217980941 CTCTTTGAGGAGATGACTTTGGG - Intronic
947382704 2:229560581-229560603 CTCTTTCAGAAGGTGGGATAAGG + Intronic
947662768 2:231882327-231882349 CTCCTTCAGAATATCCCATAAGG - Intergenic
948331917 2:237175864-237175886 CTCTTTCAGATAGTGCCATGTGG - Intergenic
949086497 2:242160294-242160316 AACTTTGAGAAGATGCCCTTGGG + Intergenic
1169307418 20:4504274-4504296 ATCTTTCAGAAGATGACAGAGGG + Intergenic
1171329109 20:24321836-24321858 AGCCTTCAGAAGATGACATTTGG + Intergenic
1172604164 20:36203336-36203358 CTGCTTCACAAGTTGCCATTTGG + Intronic
1173055099 20:39604274-39604296 CTCATGCAGAAGATACCTTTAGG + Intergenic
1173953990 20:47016633-47016655 CTCTTTGAAGAGATGACATTGGG + Intronic
1174561430 20:51433206-51433228 CTCTTTGAGGAGCTGACATTTGG - Intronic
1174724142 20:52843694-52843716 CTCTTTCACAAGAGGCCACTGGG + Intergenic
1174730360 20:52910006-52910028 CTCTCTCAGAAGGGGGCATTTGG - Intergenic
1176091324 20:63319820-63319842 CTCCTGCAGCAGGTGCCATTTGG + Intronic
1177225708 21:18252504-18252526 CTCTTTCAGCTGATCACATTTGG - Intronic
1178783715 21:35632755-35632777 CTCTTTTAGAAGATACAATCGGG - Intronic
1179187740 21:39097570-39097592 CTTTTTCAGAAGATGACCTTTGG + Intergenic
1180121833 21:45757087-45757109 CTTTTTGAGAAGATGCCAAGTGG + Intronic
1181989476 22:26826317-26826339 GACTTTCAGAAGATGCCCATTGG - Intergenic
1182031500 22:27162808-27162830 CTCTCTGAGAAGAAGTCATTTGG + Intergenic
1184299810 22:43551138-43551160 CTCTTTCAAAAAATGGCATGAGG + Intronic
951410933 3:22365799-22365821 CTCTTTCAGAGGATGCTATGGGG - Intronic
953727608 3:45414001-45414023 GTCTTTCTGGGGATGCCATTTGG + Intronic
955060543 3:55488653-55488675 CTCTTTCAGCAGATGCCGCGGGG - Intronic
955352675 3:58205649-58205671 CCCTTCCACATGATGCCATTGGG - Intronic
956297950 3:67735418-67735440 CTTTTGAAGTAGATGCCATTAGG + Intergenic
956468956 3:69544907-69544929 ATTTTTCAGAAGATGGAATTTGG - Intergenic
956745338 3:72306694-72306716 CTCTGTCATTAGAAGCCATTGGG + Intergenic
957607762 3:82425445-82425467 CTCTTTTAGGAGATGGCATTGGG - Intergenic
959146265 3:102549001-102549023 CTTTTTCAGAAGCTTACATTAGG + Intergenic
959634879 3:108554584-108554606 CTCTTCCAGCATATGCAATTTGG - Intronic
962003964 3:131329665-131329687 CTCTCTGAGAAGATGACATGAGG + Intronic
966527372 3:180934246-180934268 ATCTTTGAGCAGCTGCCATTTGG + Intronic
966779551 3:183572060-183572082 CTCATTCTGAAGCTGCCAATAGG + Intergenic
967600631 3:191383732-191383754 ATCTTTCAGAAAATTACATTGGG + Intronic
969038890 4:4278175-4278197 CTCTTTCAGAAGGTACAAATTGG - Intronic
969242315 4:5907891-5907913 CTCTATGAGAAGGTGCCATGAGG + Intronic
972777270 4:42253170-42253192 CTCATACAGGAGATGCCTTTAGG - Intergenic
974328409 4:60444949-60444971 CTCATTAAGAAGATGACATTTGG - Intergenic
974419981 4:61661707-61661729 ATCTTTCAGAACATTGCATTAGG + Intronic
975772863 4:77747967-77747989 CTCTCTATGAAGATGCCATTTGG + Intronic
975772870 4:77748057-77748079 CTCTCTATGAAGATGCTATTTGG + Intronic
976916863 4:90386831-90386853 GTCTTTCTAAAGATGTCATTTGG - Intronic
977101001 4:92814916-92814938 CTCTGTCAGTACATGACATTGGG - Intronic
977468813 4:97415742-97415764 CTCTTTAAGAAGAGGCTATTTGG - Intronic
979990146 4:127366008-127366030 TTCTTTGAGATGAGGCCATTTGG - Intergenic
981275448 4:142893718-142893740 TGCTTTCAGAAGCTGGCATTGGG - Intergenic
981385243 4:144122905-144122927 ATGTTTCAGAAGAGCCCATTTGG - Intronic
981541303 4:145849402-145849424 CCCTTACAGAAGATGCCAGAGGG - Exonic
982255182 4:153444519-153444541 CTCATTAAAAAGATGACATTTGG - Intergenic
982303250 4:153901471-153901493 CTCTTGCAGGAGATGCTATGTGG + Intergenic
982819310 4:159926702-159926724 CTCTTTCAGATGCTTGCATTTGG + Intergenic
985121148 4:186643448-186643470 CTCTCTCTGGAGATGGCATTAGG - Intronic
986242083 5:5970267-5970289 CTAGTTCAGATGATGTCATTAGG + Intergenic
987057251 5:14205654-14205676 GTGTTTCAGAAGATGCCAGTTGG + Intronic
987754344 5:22081533-22081555 CTATTCTAGAATATGCCATTAGG + Intronic
988405059 5:30813822-30813844 ATATTTTAGAAGCTGCCATTTGG - Intergenic
989956017 5:50361051-50361073 CTCTGACATAAGAAGCCATTGGG - Intergenic
991248578 5:64534100-64534122 CTTTTTGGGAAGATGACATTTGG + Intronic
991283723 5:64945152-64945174 CTCATTGAGAAGGTGACATTTGG - Intronic
991478400 5:67049122-67049144 TTCTTTCAGTAGTTGCCTTTTGG + Intronic
991488940 5:67165086-67165108 CTCTTTCAGACGATTCCCTCAGG - Exonic
991955035 5:71985806-71985828 CAGTTTCAGAAGTTTCCATTTGG - Intergenic
993708720 5:91200770-91200792 ATATTTCAGAATTTGCCATTAGG - Intergenic
995922270 5:117328559-117328581 CAGTTTCAGAAGTTTCCATTTGG - Intergenic
995987499 5:118196659-118196681 CTCTTTGAGAAGATGGATTTAGG - Intergenic
996814850 5:127563500-127563522 CTGTTTCAGAACACCCCATTTGG + Intergenic
998169750 5:139865599-139865621 CTCTGTCCGAAGAATCCATTTGG + Exonic
998437302 5:142122915-142122937 TTCATTCAGAAGACACCATTAGG - Intronic
999280160 5:150359900-150359922 CTCATTGAGAAGGTGTCATTTGG + Intronic
1000186326 5:158861783-158861805 CTATTTCAAAATATGCCACTTGG - Intronic
1001320266 5:170674917-170674939 TTCTTTCAGAACCTGTCATTGGG - Intronic
1001436759 5:171705217-171705239 CCCTTTCAAAGGATGCCTTTGGG - Intergenic
1001947795 5:175795194-175795216 CTCTTTGACAAGGTGACATTTGG + Intergenic
1002744975 5:181463139-181463161 AACTTTGAGAAGATGCCCTTGGG + Intergenic
1003127988 6:3371284-3371306 CTCTAGCAGCAGATGCCATGTGG - Intronic
1003147553 6:3521443-3521465 CTCTTCCCGTATATGCCATTTGG + Intergenic
1003622558 6:7713728-7713750 CTCTTCCAGATGATGCCAGAAGG - Intergenic
1004078152 6:12364185-12364207 CTTTTTCCTCAGATGCCATTAGG - Intergenic
1005444213 6:25904436-25904458 CTCATTGAAAAGATGACATTTGG - Intergenic
1005782680 6:29209257-29209279 CTCTTCCAGCAGATTCAATTGGG - Intergenic
1006430261 6:33991265-33991287 CGTTTTCAGAAGCTGCCACTTGG + Intergenic
1006612483 6:35302703-35302725 ATTTTTCACAAGTTGCCATTTGG - Intronic
1006765894 6:36506409-36506431 CTCCTTCAAAAGATTCCTTTCGG + Intronic
1009420035 6:63455284-63455306 CCCTTTCAGAAATTGCCCTTGGG - Intergenic
1009433211 6:63589180-63589202 CACTCTCAAAAGATGACATTTGG + Intergenic
1009554115 6:65139832-65139854 GTATGTCAAAAGATGCCATTTGG + Intronic
1009582436 6:65553206-65553228 CTGTTTCAGATGAAGCCACTTGG - Intronic
1011722667 6:90175529-90175551 CTCTTTCAAAAGAAGGGATTAGG - Intronic
1013491469 6:110650612-110650634 CTCTTTGAGAAGATAACATTTGG + Intronic
1013869606 6:114741374-114741396 TCCTTTCAAAAGATGCCATTTGG - Intergenic
1016131034 6:140471003-140471025 CTCTTTCACAATAGGCAATTAGG + Intergenic
1016829074 6:148415847-148415869 CTCATTCAGAGGATTCCCTTTGG + Intronic
1019249887 6:170736683-170736705 AACTTTGAGAAGATGCCCTTGGG + Intergenic
1020982297 7:15086093-15086115 CTTTTGCTGAAGATGCCTTTGGG - Intergenic
1021143447 7:17055650-17055672 CTCTTTCAGATGAGGCAATGGGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022769286 7:33451810-33451832 TTTTTGCAGAATATGCCATTGGG + Intronic
1030084079 7:105802446-105802468 CTGTTTCAGCAGATACCACTGGG + Intronic
1031295001 7:119990939-119990961 CTCTTTCAGGAGCTGTCATAAGG - Intergenic
1032255703 7:130295474-130295496 CTCTTTCTGAAGATGGAAATTGG - Intronic
1032418859 7:131761755-131761777 CTCATTGAGAAGGTGACATTTGG + Intergenic
1032502241 7:132408871-132408893 CTCTTAGAGAAGATGACATGGGG - Intronic
1032907669 7:136389303-136389325 CTCATTGAGAAGCTGCCAATAGG - Intergenic
1033510361 7:142054850-142054872 CTCATTAAGAAGAATCCATTTGG + Exonic
1033513153 7:142080887-142080909 CTCATTAAGAAGAATCCATTTGG + Intronic
1035498212 8:70975-70997 AACTTTGAGAAGATGCCCTTGGG - Intergenic
1036686595 8:10915742-10915764 CATTTTGAGGAGATGCCATTTGG - Intronic
1037702159 8:21285002-21285024 CTGTTTCAGAAGTTCCCAGTTGG - Intergenic
1041283073 8:56231132-56231154 CAGTTTCAGAATATGCCATGAGG - Intergenic
1042156887 8:65853963-65853985 TGCTTTAAGAAGATGGCATTGGG + Intergenic
1042519628 8:69697598-69697620 CTCTCTGAGAAGGTGGCATTAGG + Intronic
1042684154 8:71418858-71418880 CTCTCTGATAAGATGACATTTGG + Intronic
1043471757 8:80569950-80569972 CTCCTTCAGAAGGAGCCATGAGG - Intergenic
1044866840 8:96579970-96579992 CTCTGTAAAAAGCTGCCATTCGG - Intronic
1045117002 8:98993306-98993328 CTCTTACAAAAGATGTCAGTGGG - Intergenic
1046381498 8:113456240-113456262 CACTTTCATTAGAAGCCATTTGG + Intergenic
1046474564 8:114725022-114725044 CTCTTTGAGAAATTGCCATACGG - Intergenic
1046560100 8:115825443-115825465 TTCTTTCAGAAAATGCCACATGG + Intergenic
1047432648 8:124806077-124806099 CCCTTTCAGAATATGCCACAAGG - Intergenic
1048154813 8:131936554-131936576 CTCTCTCTCAAGATGCCAGTTGG + Intronic
1049009866 8:139880139-139880161 CTCTTCCCGAAGAAGCCATGTGG - Intronic
1051377379 9:16416702-16416724 CTCCTTCAGAGGATGCTATGGGG - Exonic
1052444691 9:28545422-28545444 CTCTTTCATAAGTTGCAAATGGG - Intronic
1052490895 9:29166279-29166301 TTATTTCAGAAGTTGCAATTTGG + Intergenic
1052791226 9:32877129-32877151 CTTATTCAGAAGTTGACATTAGG + Intergenic
1054861863 9:69962159-69962181 ATCATTCAGAAGATGTCATCTGG - Intergenic
1057432478 9:95006559-95006581 CTCTCTCAGAAGCTGCCCTCTGG - Intronic
1058348147 9:103989472-103989494 TTCTTTTATAAGATGTCATTTGG - Intergenic
1059101445 9:111475991-111476013 CTCTTTTAGAGGATGAGATTTGG - Intronic
1059549374 9:115213432-115213454 CCCTGTGAGAAGATGACATTTGG - Intronic
1059784520 9:117566003-117566025 GCCTTTAAGAAGATGCTATTTGG + Intergenic
1060456294 9:123801898-123801920 ATCTTTCAAAAGATGCACTTAGG + Intronic
1062080587 9:134621431-134621453 CTCATTCAGCAGATGCCGTAGGG - Intergenic
1203656045 Un_KI270752v1:25773-25795 GTCCTTCAGAAGATGCTGTTGGG + Intergenic
1186043649 X:5509332-5509354 CCTTTTAAGAAGAGGCCATTAGG + Intergenic
1187457336 X:19453724-19453746 TTCTTTCACAAGATGCTTTTAGG + Intronic
1189411209 X:40773319-40773341 CTCTGTGAGGAGATGCCGTTAGG - Intergenic
1189437803 X:41008300-41008322 CTCTTTGAGGAGGTGCCGTTGGG - Intergenic
1191016426 X:55814194-55814216 CTCTTTCAGTCTTTGCCATTTGG - Intergenic
1191592068 X:62897319-62897341 TTCTTTCAGAAGTTCCCACTTGG + Intergenic
1192432593 X:71122400-71122422 CTCTTTCAGAAGTAGTGATTTGG + Intronic
1194988588 X:100520043-100520065 CACTTTCAAAAGATGACATTTGG + Intergenic
1195536835 X:106018044-106018066 CTCTTTCAGTTTATCCCATTTGG + Intergenic
1196042936 X:111225461-111225483 CTCCTTTAGAAGCTGCCATCAGG + Intronic
1196779320 X:119368598-119368620 CTCTTTGAGGAGGTGACATTTGG + Intergenic
1198527959 X:137521251-137521273 CCCCTTAAGAAGATGACATTTGG + Intergenic
1201586458 Y:15566605-15566627 CTCTGACAGAAGATACCATCAGG + Intergenic