ID: 1148776310

View in Genome Browser
Species Human (GRCh38)
Location 17:50097355-50097377
Sequence AGCCAAAGGATGTCTCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148776310_1148776313 -9 Left 1148776310 17:50097355-50097377 CCTGGCCGAGACATCCTTTGGCT 0: 1
1: 0
2: 0
3: 1
4: 117
Right 1148776313 17:50097369-50097391 CCTTTGGCTTTCATAGTCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1148776310_1148776314 -1 Left 1148776310 17:50097355-50097377 CCTGGCCGAGACATCCTTTGGCT 0: 1
1: 0
2: 0
3: 1
4: 117
Right 1148776314 17:50097377-50097399 TTTCATAGTCTGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 25
4: 268
1148776310_1148776315 23 Left 1148776310 17:50097355-50097377 CCTGGCCGAGACATCCTTTGGCT 0: 1
1: 0
2: 0
3: 1
4: 117
Right 1148776315 17:50097401-50097423 TCACCCCTCTTTCTCCTGCCAGG 0: 1
1: 0
2: 5
3: 28
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148776310 Original CRISPR AGCCAAAGGATGTCTCGGCC AGG (reversed) Intronic
904814014 1:33181887-33181909 AGCCAATGTACGGCTCGGCCTGG - Intronic
910579095 1:88801720-88801742 AGACAAAGGATCTCTCAGCAAGG + Intronic
913437579 1:118863239-118863261 AGACAAAAGATCTCTCAGCCAGG + Intergenic
915783992 1:158587398-158587420 AGACAAAGGATCTCTCAGCAAGG - Intergenic
917130386 1:171736180-171736202 ATCAAAAGCATGTCTTGGCCAGG - Intronic
917307020 1:173637762-173637784 AGACAAAGGATCTCTCAGCAAGG - Intronic
917307662 1:173642973-173642995 AGACAAAGGATCTCTCAGCAAGG - Intronic
922698517 1:227744234-227744256 AGCCCAAGGATGTGGCGGGCTGG + Intronic
923650096 1:235866273-235866295 AGTCAAAGGGTGTCACGGACAGG + Intronic
1066441511 10:35444063-35444085 AGACAAAGGATCTCTCAGCAAGG - Intronic
1070344464 10:75528332-75528354 AGCCAGAGGATGTCTGGACTTGG + Intronic
1071030739 10:81177810-81177832 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1075378706 10:122000500-122000522 AGCCAGAGATTGACTCGGCCAGG + Intronic
1076747516 10:132521864-132521886 TGCCAAAGGAGGCCTCGGACCGG + Intergenic
1078325320 11:10375864-10375886 AGCCAAAGGGTGTCTGCTCCAGG + Intronic
1084371064 11:68743765-68743787 ACTCAAAGGATGCCTAGGCCTGG - Intronic
1084583346 11:70038506-70038528 AGACAAAGGATCTCTCAGCAAGG - Intergenic
1092586074 12:9902701-9902723 AGACAAAGGATTTCTCAGCAAGG + Intronic
1092587113 12:9910957-9910979 AGACAAAGGATTTCTCAGCAAGG + Intronic
1093327388 12:17794789-17794811 AAAAAAAGTATGTCTCGGCCGGG + Intergenic
1095641170 12:44486688-44486710 AGCCTGAGGATGTCTCCACCTGG + Intergenic
1102478819 12:113206616-113206638 AGACAAAGGATCTCTCAGCAAGG - Intronic
1103514778 12:121500424-121500446 AGACAAGGGATGGCTGGGCCTGG + Intronic
1103866118 12:124053352-124053374 AGTCAAGGAAGGTCTCGGCCGGG + Intronic
1114588216 14:23834434-23834456 AGATAAAGGTTGTCTGGGCCTGG - Intergenic
1120838595 14:89063118-89063140 AGAGAGAGGATGTCTCAGCCTGG + Intergenic
1121587330 14:95071182-95071204 AGCCAACGGGTGTCTAGGGCCGG - Intergenic
1136276303 16:29181156-29181178 AGCCAAGGGATGTAGGGGCCTGG + Intergenic
1141577791 16:84975771-84975793 GGTCAAAGGATGTCTCTTCCGGG + Intronic
1142080684 16:88147215-88147237 AGCCAAGGGATGTAGGGGCCTGG + Intergenic
1144588472 17:16503501-16503523 AGCCATAGGATACCTCGCCCAGG + Intergenic
1147535424 17:41317793-41317815 TGTAAAAGGATGTGTCGGCCGGG - Intergenic
1148776310 17:50097355-50097377 AGCCAAAGGATGTCTCGGCCAGG - Intronic
1151923416 17:77174782-77174804 AGACAAAGGATTTCTCAGCAAGG + Intronic
1153833604 18:8944626-8944648 AGAAAAAGGAAGGCTCGGCCAGG - Intergenic
1154377372 18:13821358-13821380 GGACACTGGATGTCTCGGCCTGG - Intergenic
1160357116 18:78237890-78237912 AGCCCAGGGATGGGTCGGCCAGG - Intergenic
1160545591 18:79651130-79651152 ACCTAAAGGTTGTCTGGGCCAGG + Intergenic
1162889597 19:13722875-13722897 AGCCAAAAGATGTGTGGTCCAGG - Intergenic
1163697161 19:18769717-18769739 AGTCACAGGGTGTCTGGGCCAGG + Intronic
1163984823 19:20936397-20936419 AGACAAAGGATCTCTCAGCAAGG + Intronic
1164429689 19:28176359-28176381 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1165359696 19:35328689-35328711 AGGAAAAAGATATCTCGGCCGGG - Intronic
1165805730 19:38579733-38579755 AGCCAAAGGATGTTCTGGGCCGG - Intronic
1165838350 19:38772676-38772698 AGTCAAAGGATGGCTTGGCAAGG + Intronic
1165841209 19:38790021-38790043 AGTCAAAGGATGGCTTGGCAAGG - Intronic
1166908515 19:46133247-46133269 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1167838840 19:52097200-52097222 AGACAAAGGATCTCTCAGCAAGG - Intergenic
1168210980 19:54889804-54889826 AGCCAACAGATGTGTCAGCCAGG + Exonic
925853714 2:8108992-8109014 TGCCATAGGATCTCTGGGCCTGG - Intergenic
929132008 2:38585720-38585742 AGCAAAAGGATCACTCGGCCAGG - Exonic
929919602 2:46162915-46162937 AGCCCACGGATGACTCGGGCTGG - Intronic
930141274 2:47953587-47953609 AGCCAAAGGACATTGCGGCCGGG + Intergenic
931451722 2:62372992-62373014 AGACAAAGGATCTCTCAGCAAGG + Intergenic
935755406 2:106272699-106272721 AGACAAAGGATCTCTCAGCAAGG - Intergenic
935954793 2:108365100-108365122 AGACAAAGGATCTCTCAGCAAGG - Intergenic
938369979 2:130762738-130762760 GACCAAAGGATGCATCGGCCAGG - Exonic
941080625 2:161056682-161056704 AGACAAAGGATCTCTCAGCAAGG - Intergenic
942177292 2:173346267-173346289 AGACAAAGGATTTCTCAGCAAGG - Intergenic
942596753 2:177598881-177598903 AGCCCCTGGATGTCTCTGCCTGG - Intergenic
947580376 2:231312465-231312487 AGCAAAAGGATGTCCTTGCCAGG + Intronic
948437361 2:237962603-237962625 AGACAAAGGATCTCTCAGCAAGG + Intergenic
948788977 2:240367603-240367625 ACCAAAAGGATGCCTGGGCCAGG - Intergenic
1172513194 20:35514750-35514772 TGCCAAAGGCTGTCTGCGCCAGG + Exonic
1179593639 21:42427822-42427844 AACCAAAGGAAGGCTCTGCCGGG + Intronic
1179804286 21:43827067-43827089 AGCCCAGGGATGCCTAGGCCTGG - Intergenic
1179918355 21:44493022-44493044 AGACAAAGGATCTCTCAGCAAGG - Intergenic
1182117573 22:27765979-27766001 AGCCAAAGGCTGGATCTGCCGGG - Intronic
949458213 3:4262089-4262111 AGCCAAAATATGTCTATGCCCGG + Intronic
955497955 3:59556074-59556096 AGCCCGAGGATGTCTCTCCCTGG - Intergenic
957409291 3:79817012-79817034 AGCCAAAGGAAGCCTGGGCATGG - Intergenic
959839999 3:110964517-110964539 AGACAAAGGATCTCTCAGCAAGG + Intergenic
966683264 3:182666382-182666404 AGAAAAAATATGTCTCGGCCGGG + Intergenic
973849065 4:54943492-54943514 AGCCATAGGTAATCTCGGCCTGG + Intergenic
977610013 4:99021551-99021573 AGACAAAGGATCTCTCAGCAAGG + Intronic
984137203 4:175955636-175955658 AGCCAAATGATGTCACAGTCAGG - Intronic
986161067 5:5229509-5229531 AGACAAAGGATCTCTCAGCAAGG - Intronic
986776134 5:11015853-11015875 AGGCAAATGAAGTCTCGCCCAGG - Intronic
987317401 5:16736515-16736537 AGTCAAATGATGTCACGACCAGG + Intronic
988868986 5:35367288-35367310 GGTCAAAGGATGTCTCAGCTTGG + Intergenic
993856643 5:93084478-93084500 AGCCTAAGCAAGTCTCTGCCGGG + Intergenic
995402550 5:111758190-111758212 AGCCACAGGACCTCTGGGCCCGG - Intronic
997398322 5:133582093-133582115 AGCCAGAGGATGGCTTGGGCAGG + Intronic
1001679415 5:173545173-173545195 AGCCAGAGGAAGTCTTGTCCGGG + Intergenic
1003153456 6:3571854-3571876 ATCCAAATGATGTCTTAGCCAGG - Intergenic
1004399635 6:15276466-15276488 AGCCAAAGGAGGTCTGGGGTTGG + Intronic
1004858948 6:19781551-19781573 AGCCAAAGGCTGTGATGGCCCGG + Intergenic
1005921920 6:30409352-30409374 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1006652995 6:35566874-35566896 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1007687149 6:43673707-43673729 AGACAAAGCATGGCTCCGCCAGG + Intronic
1010831490 6:80536081-80536103 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1016355997 6:143218951-143218973 AACCAAAAGATGTTTCAGCCAGG - Intronic
1017761603 6:157573818-157573840 AGCCCCAGGATGTCCCTGCCAGG + Intronic
1019699673 7:2468570-2468592 AGCCCCAGGAAGTCTCAGCCTGG - Intergenic
1023181490 7:37488267-37488289 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1026489434 7:70850060-70850082 AGACAAAGGATTTCTCAGCAAGG - Intergenic
1039644663 8:39267592-39267614 AGACAAAGGATCTCTCAGCAAGG + Intronic
1039792832 8:40889055-40889077 AGCAAAAGGCTGTCTTGGTCAGG - Intronic
1040622393 8:49104342-49104364 AGACAAAGGATCTCTCAGCAAGG - Intergenic
1040913731 8:52546846-52546868 AGACAAAGGATCTCTCAGCAAGG - Intronic
1047530375 8:125668721-125668743 AGCCTGAGGATGTCTGGTCCTGG + Intergenic
1049575661 8:143388632-143388654 CGCCAGGGGATGTCTCAGCCTGG + Intergenic
1049927202 9:420992-421014 AGTCAAGGGATGTCAAGGCCCGG + Exonic
1053560411 9:39187724-39187746 AGCCAAAGGAAGTCACTGGCTGG + Intronic
1053824516 9:42007968-42007990 AGCCAAAGGAAGTCACTGGCTGG + Intronic
1054136707 9:61431231-61431253 AGCCAAAGGAAGTCACTGGCTGG - Intergenic
1054606056 9:67179395-67179417 AGCCAAAGGAAGTCACTGGCTGG - Intergenic
1060134273 9:121136604-121136626 ACCTAAAAGAGGTCTCGGCCAGG - Intronic
1061505754 9:131031042-131031064 TGCCAGAGGATGCCTTGGCCAGG - Intronic
1062366367 9:136211302-136211324 AGCCAGAGGATGGCTTGGTCTGG + Exonic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186144819 X:6614289-6614311 ATCCCAAGGCTGTCTGGGCCTGG - Intergenic
1186244074 X:7601917-7601939 AGACAAAGGATCTCTCAGCAAGG - Intergenic
1187207745 X:17198800-17198822 AGCCAAGGGATGTGTGAGCCAGG - Intergenic
1189148910 X:38684553-38684575 AGCCATGGGATGTCTGGGCATGG + Intronic
1189799403 X:44677906-44677928 AACCAAACTCTGTCTCGGCCGGG - Intergenic
1196127285 X:112113660-112113682 AGACAAAGGTTCTCTGGGCCAGG - Intergenic
1198854087 X:140997422-140997444 AGACAAAGGATCTCTCAGCAAGG + Intergenic
1198877924 X:141247693-141247715 AGACAAAGGATCTCTCAGCAAGG - Intergenic