ID: 1148777702

View in Genome Browser
Species Human (GRCh38)
Location 17:50104917-50104939
Sequence GGGGTGTTGTTGCATCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148777702_1148777709 -4 Left 1148777702 17:50104917-50104939 CCCACTGGATGCAACAACACCCC 0: 1
1: 0
2: 1
3: 15
4: 110
Right 1148777709 17:50104936-50104958 CCCCGGCGGGGAGAAACATTAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1148777702_1148777714 15 Left 1148777702 17:50104917-50104939 CCCACTGGATGCAACAACACCCC 0: 1
1: 0
2: 1
3: 15
4: 110
Right 1148777714 17:50104955-50104977 TAGGAGCTGTTTCCACACTGGGG 0: 1
1: 0
2: 2
3: 110
4: 278
1148777702_1148777712 13 Left 1148777702 17:50104917-50104939 CCCACTGGATGCAACAACACCCC 0: 1
1: 0
2: 1
3: 15
4: 110
Right 1148777712 17:50104953-50104975 ATTAGGAGCTGTTTCCACACTGG 0: 1
1: 0
2: 1
3: 12
4: 116
1148777702_1148777713 14 Left 1148777702 17:50104917-50104939 CCCACTGGATGCAACAACACCCC 0: 1
1: 0
2: 1
3: 15
4: 110
Right 1148777713 17:50104954-50104976 TTAGGAGCTGTTTCCACACTGGG 0: 1
1: 0
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148777702 Original CRISPR GGGGTGTTGTTGCATCCAGT GGG (reversed) Intronic
900029256 1:359102-359124 GAGGTGTAGGTGCAGCCAGTGGG - Intergenic
900049858 1:587874-587896 GAGGTGTAGGTGCAGCCAGTGGG - Intergenic
903377255 1:22874585-22874607 GGGGTGTGGGGGCATCCTGTCGG + Intronic
905376242 1:37522665-37522687 GAGGTGGTGTTGCATCATGTTGG - Intergenic
908566627 1:65363573-65363595 GGGGTGATTTTGCCTCCACTAGG + Intronic
910426379 1:87123393-87123415 GGGGTATGGTTGTATGCAGTGGG + Intronic
914978427 1:152389344-152389366 GGGATTTTGTTGCGTGCAGTGGG - Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
918294416 1:183142749-183142771 GGGGTGTTGAAGCAGCCAGATGG - Exonic
921965123 1:221079884-221079906 GGGGTATAGTTGCTTCCTGTTGG - Intergenic
923017439 1:230137621-230137643 GGGGTCTTGATGCTTCCACTGGG - Intronic
924633591 1:245764589-245764611 GGGGTGTGGTAGGATCTAGTTGG - Intronic
1063128207 10:3154030-3154052 GGGGTGTGGTTGACTGCAGTGGG - Intronic
1069058067 10:63865424-63865446 TGGGTGTTGCTGCATCCATTGGG - Intergenic
1070789624 10:79181502-79181524 GGGGTCTGGTTGCAGCCGGTGGG - Intronic
1071413343 10:85418545-85418567 GGGTTGTTGTTGAATCAAGTTGG - Intergenic
1071510847 10:86261706-86261728 GGGGTTTTGCTGCATCCAGCAGG - Intronic
1074463352 10:113659302-113659324 GGGGTATTATTGCATCTGGTGGG - Intronic
1075092940 10:119453605-119453627 GGCGTGTTGCTGCATCTGGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1076638232 10:131897337-131897359 GGGGTGTTCGTTCAGCCAGTGGG - Intergenic
1078411671 11:11126155-11126177 GATGTGTTGTTGGATTCAGTTGG + Intergenic
1090387928 11:126367253-126367275 GGGGTGTGGTGGCATGCAGAAGG - Intronic
1090390567 11:126384699-126384721 GGGGTGTGGTGGCATGCAGAAGG - Intronic
1091638360 12:2215220-2215242 GGTGTTCTGTTGCATTCAGTGGG + Intronic
1093613011 12:21185251-21185273 AGGATGTTTTTGGATCCAGTTGG - Intronic
1096519650 12:52177445-52177467 GGGGCCTGGCTGCATCCAGTCGG - Intronic
1104654120 12:130560440-130560462 GGGGTCTAGTGGCATCCAGTGGG - Intronic
1106486985 13:30180919-30180941 GAGGTGCTGGAGCATCCAGTGGG + Intergenic
1110714038 13:78681663-78681685 TTGGTGATGTTGCATGCAGTGGG + Intergenic
1113094254 13:106646919-106646941 AGGTTGTTATTTCATCCAGTTGG + Intergenic
1114361469 14:21978376-21978398 AGGGCGATGTTGCATCAAGTAGG + Intergenic
1116711993 14:48380039-48380061 GAGGAGTTGTAGCATCAAGTAGG - Intergenic
1119052028 14:71378436-71378458 GGTGTGTTGTTTCATACATTGGG + Intronic
1119989193 14:79175976-79175998 GAGGTGTTGTTGCTTCCTTTAGG + Intronic
1127311209 15:57753762-57753784 GAGGAGCTGTTGCTTCCAGTTGG + Intronic
1127682967 15:61315478-61315500 GGGGTGATGTTGGAACCAGCTGG + Intergenic
1128630182 15:69257243-69257265 GGTGTGTTTATTCATCCAGTTGG + Intronic
1131788410 15:95937775-95937797 GGGGTGTATAGGCATCCAGTGGG - Intergenic
1132558999 16:584913-584935 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559019 16:584965-584987 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559039 16:585017-585039 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559059 16:585069-585091 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559079 16:585121-585143 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559099 16:585173-585195 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559119 16:585225-585247 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559139 16:585277-585299 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132559159 16:585329-585351 GGGGTGTTGGTGGACCCGGTGGG - Intergenic
1132646762 16:1002798-1002820 GGGGTGCTGTGGCATCCAGCGGG - Intergenic
1141656080 16:85417325-85417347 GGGGTGATGTTGCCCCCAGGGGG - Intergenic
1147565134 17:41531287-41531309 GGGGTTCTGTAGAATCCAGTTGG - Intergenic
1148604333 17:48917425-48917447 TGGGGGTTGTGGCATCCAGTGGG + Intronic
1148777702 17:50104917-50104939 GGGGTGTTGTTGCATCCAGTGGG - Intronic
1149604373 17:57914529-57914551 GGGATCCTGTTGCATCCATTTGG + Intronic
1152950502 17:83227454-83227476 GAGGTGTAGGTGCAGCCAGTGGG + Intergenic
1153059807 18:983182-983204 TGGGTGTTGTTAAATCCAATGGG + Intergenic
1153466881 18:5397925-5397947 AGTGTGTGGTTGCATCCAGCTGG - Intronic
1163436449 19:17298619-17298641 ATTGTGTAGTTGCATCCAGTGGG + Intronic
1166098268 19:40555036-40555058 GGGGTGATGTTGCCTCGTGTAGG + Intronic
1167504469 19:49863805-49863827 GGGCTGGGGTGGCATCCAGTAGG - Intronic
925197892 2:1941981-1942003 GGGTAGTTGTTTCAGCCAGTGGG - Intronic
926759032 2:16261157-16261179 GGGGAGTTGATGGATCCTGTGGG + Intergenic
927822589 2:26281427-26281449 AGGGTGGTGTTCCATCCTGTTGG - Intronic
927871032 2:26623829-26623851 GAGCTGTAGTTGCATCCACTGGG - Intronic
941335497 2:164239432-164239454 CCAGTGTGGTTGCATCCAGTTGG + Intergenic
948925471 2:241094010-241094032 AGGCTGTTGTTGTACCCAGTCGG - Exonic
1172219021 20:33259542-33259564 GGGTTTTTGTTTCATTCAGTAGG + Intergenic
1179032687 21:37734420-37734442 GAGGAGTTCTTGGATCCAGTGGG + Intronic
1180606810 22:17065157-17065179 GGGGTGGTATTCCAGCCAGTGGG - Intergenic
1180952787 22:19728306-19728328 GGGGTGTTGGTGGAGCCTGTGGG - Intergenic
1184050113 22:41998046-41998068 GGGTTGTTCTTGCATCCCCTAGG - Exonic
1185159492 22:49214657-49214679 GGGTTGCTGTTGCATGCAGTAGG + Intergenic
949484245 3:4522456-4522478 GGTGTTGAGTTGCATCCAGTTGG + Intronic
949905611 3:8856060-8856082 GCTGTGCTGTTGCATCTAGTGGG + Intronic
950548023 3:13650374-13650396 GAGGAGGTGTTGCCTCCAGTGGG + Intergenic
952852273 3:37739206-37739228 GGGGTGTTCTTGAATTTAGTAGG - Intronic
952952449 3:38536150-38536172 GGTGTGTTATTGCTTCCAGTTGG + Intronic
957326783 3:78706098-78706120 GGGCAGTAGTAGCATCCAGTGGG + Intronic
959050710 3:101522494-101522516 GGGGTGTTGCTGCATCTTTTTGG - Intergenic
961064898 3:123866965-123866987 GGGGTGTTCTAGGAGCCAGTGGG - Intronic
962264685 3:133936417-133936439 GGGGTGTTGTCTAATCCAATAGG - Intronic
962705746 3:138042584-138042606 GGGGTGTGGATGCATCCATAAGG - Intergenic
962746941 3:138403871-138403893 CGGGTGTCTTGGCATCCAGTTGG - Exonic
969401790 4:6960753-6960775 GGGGTGTTGGAGCCTCCAGGCGG + Intronic
971536959 4:27765078-27765100 GTGGTGTTATGACATCCAGTTGG + Intergenic
973645798 4:52950319-52950341 TGGGTGGTGTTGAATGCAGTTGG + Intronic
974318978 4:60319232-60319254 TATGTGTTATTGCATCCAGTGGG - Intergenic
982891662 4:160860921-160860943 GGAGTGTGTTTGCTTCCAGTTGG - Intergenic
986826741 5:11530580-11530602 GGGGTGTTGTGGCATCCACAGGG + Intronic
987387082 5:17340083-17340105 GGTGTGTTGGTGCTTCCAGAAGG + Intergenic
996999877 5:129747007-129747029 GGGGTGTTCTTGAATCAAGCAGG - Intergenic
999862491 5:155663448-155663470 GGGGTTCTGTTGCAGTCAGTAGG + Intergenic
1001494584 5:172178905-172178927 GAGGTGTTCTGGCATCCAGTGGG + Intronic
1002323052 5:178387119-178387141 AGGGTGTTGTTGGTTCCAGACGG - Intronic
1002744734 5:181461269-181461291 GAGGTGTAGGTGCAGCCAGTGGG + Intergenic
1004188859 6:13446837-13446859 AGGATGTTGTTGCTGCCAGTTGG - Intronic
1008908128 6:56702957-56702979 GTGCTTTTGTTGGATCCAGTGGG - Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1012079703 6:94740520-94740542 GATGTGTTGTTGGATTCAGTTGG - Intergenic
1012274470 6:97256108-97256130 GAGGTGTTGATGGATACAGTAGG - Intronic
1015502131 6:133945333-133945355 GGGGTGTTGTTGCAGGAACTGGG + Intergenic
1019249645 6:170734810-170734832 GAGGTGTAGGTGCAGCCAGTGGG + Intergenic
1020052228 7:5089254-5089276 GAGGTTTTCTTGCATGCAGTTGG - Intergenic
1021894674 7:25222668-25222690 GGGATGTTGTGGGATCCAGCAGG + Intergenic
1022822530 7:33975036-33975058 GGGGTTTACTGGCATCCAGTTGG - Intronic
1026986503 7:74558483-74558505 GGGGTGTAGTTCCAGCCACTTGG - Intronic
1028085529 7:86632289-86632311 GGGGTTTTGTTTCACCAAGTAGG - Intergenic
1033252699 7:139775054-139775076 GGGGTGCTGCTGCACCAAGTTGG - Intronic
1035498451 8:72846-72868 GAGGTGTAGGTGCAGCCAGTGGG - Intronic
1035873192 8:3157701-3157723 ACGGAGTTGCTGCATCCAGTGGG + Intronic
1038254153 8:25935196-25935218 GGGGTGTTGCTGCAGCCAGTTGG + Intronic
1043452528 8:80382365-80382387 GGTGTCTTCTTGCATCCTGTCGG + Intergenic
1047562072 8:125997755-125997777 GGTGTTTTGTTGCAGCCAGAAGG + Intergenic
1048316084 8:133363298-133363320 GGGGTGTTGCTTCATCCATAGGG + Intergenic
1049048916 8:140176200-140176222 GGGGTGGTTTTGCATACACTTGG - Intronic
1062032567 9:134368289-134368311 GAGGTGCTGTTCCGTCCAGTGGG + Intronic
1203610545 Un_KI270748v1:91748-91770 GAGGTGTAGGTGCAGCCAGTGGG + Intergenic
1185481013 X:446325-446347 GGGGGTGTGTTGCATCCATTGGG - Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1187274505 X:17806021-17806043 GTGGTCTGGGTGCATCCAGTGGG + Intronic
1187457751 X:19457853-19457875 GGTGTGCTGTGGCTTCCAGTGGG - Intronic
1190520147 X:51270395-51270417 TGGTTGTTTTTCCATCCAGTAGG + Intergenic
1192215617 X:69156268-69156290 GGGGTCTAGCTGCAGCCAGTTGG + Intergenic
1200850685 Y:7880173-7880195 GGGGTGTTGTCCCATACAGTCGG - Intergenic
1202268000 Y:23041056-23041078 GGGGTGTTGTGCCATACAGTTGG + Intergenic
1202420992 Y:24674800-24674822 GGGGTGTTGTGCCATACAGTTGG + Intergenic
1202449794 Y:24995282-24995304 GGGGTGTTGTGCCATACAGTTGG - Intergenic