ID: 1148780061

View in Genome Browser
Species Human (GRCh38)
Location 17:50116293-50116315
Sequence CCCATTAGGTCCCATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148780061_1148780066 26 Left 1148780061 17:50116293-50116315 CCTGCTTCATGGGACCTAATGGG 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1148780066 17:50116342-50116364 ATAAAACGTTCCAAAAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 187
1148780061_1148780065 22 Left 1148780061 17:50116293-50116315 CCTGCTTCATGGGACCTAATGGG 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1148780065 17:50116338-50116360 AACTATAAAACGTTCCAAAAAGG 0: 1
1: 0
2: 3
3: 20
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148780061 Original CRISPR CCCATTAGGTCCCATGAAGC AGG (reversed) Intronic