ID: 1148780061

View in Genome Browser
Species Human (GRCh38)
Location 17:50116293-50116315
Sequence CCCATTAGGTCCCATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148780061_1148780066 26 Left 1148780061 17:50116293-50116315 CCTGCTTCATGGGACCTAATGGG 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1148780066 17:50116342-50116364 ATAAAACGTTCCAAAAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 187
1148780061_1148780065 22 Left 1148780061 17:50116293-50116315 CCTGCTTCATGGGACCTAATGGG 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1148780065 17:50116338-50116360 AACTATAAAACGTTCCAAAAAGG 0: 1
1: 0
2: 3
3: 20
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148780061 Original CRISPR CCCATTAGGTCCCATGAAGC AGG (reversed) Intronic
901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG + Intronic
902606517 1:17572281-17572303 CCCACAAGGCCCCATGGAGCAGG - Intronic
903384796 1:22919273-22919295 CAGATTAGGACCCATGAAGTAGG + Intergenic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
909432477 1:75605635-75605657 CCCATTAGGGCCCATGACAGAGG - Intronic
912558468 1:110533332-110533354 CCCCTTAGATGCCAGGAAGCTGG - Intergenic
918884931 1:190180168-190180190 CCCATTAGATCCTTTGAAGTAGG - Intronic
922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG + Intronic
1073851943 10:107631811-107631833 CCCAGTAGGGCCCATGTAGCAGG - Intergenic
1081318251 11:41658396-41658418 CCTACTAGGTTCCATGAAGTTGG + Intergenic
1084728083 11:70954929-70954951 TCCATGTGGTCCCACGAAGCAGG - Intronic
1090425673 11:126605468-126605490 TCCATCATGTCCCATGAAGTAGG - Intronic
1100174941 12:92018863-92018885 TGTAATAGGTCCCATGAAGCAGG - Intronic
1101652405 12:106689502-106689524 CTCATGAGATCCCATGAAGCAGG + Intronic
1104643595 12:130482322-130482344 CCTACTAGGTGCCAAGAAGCTGG + Intronic
1109811495 13:67519043-67519065 TCTATTAGCTTCCATGAAGCTGG + Intergenic
1110162994 13:72401839-72401861 CCCATGAGCCCCCATGCAGCTGG - Intergenic
1123767801 15:23499180-23499202 CCCATTAGGCCCCAGGAAGCTGG - Intergenic
1136269203 16:29138559-29138581 CCCCTTTGCTCCCCTGAAGCAGG - Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149662208 17:58339909-58339931 GCCATAAGATCCCAGGAAGCGGG - Intergenic
1150819469 17:68423655-68423677 CCCATTCAGTGCCAGGAAGCTGG - Intronic
1151617974 17:75226813-75226835 TCCATTAGGTGCCAAGAAACAGG - Intronic
1158485605 18:57863216-57863238 GTCAATAAGTCCCATGAAGCAGG - Intergenic
1158666211 18:59434946-59434968 ACCATTAGGTGCCATGATCCAGG - Exonic
1159428053 18:68314634-68314656 CCCATTAGTTACTTTGAAGCCGG + Intergenic
1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG + Intergenic
938382348 2:130843701-130843723 CCAATTATGTCCCAACAAGCAGG - Intronic
1170029577 20:11931130-11931152 CCCATTTGTTTACATGAAGCTGG + Intergenic
1180595124 22:16967981-16968003 CCCATGAGGTCCCCTGGAGCAGG - Intronic
1182269046 22:29141957-29141979 TCCCTAAGGTCCCCTGAAGCAGG - Exonic
1183541019 22:38429518-38429540 CCCCGTAGGTCCCATGAGGTAGG - Intronic
1184245747 22:43235021-43235043 GGCATTAGCTCCCATGAAGAGGG - Intronic
952522062 3:34171120-34171142 CACATTAGGGACAATGAAGCAGG + Intergenic
952966203 3:38622707-38622729 CCTATTAGGTGTCATGGAGCAGG - Intronic
963375393 3:144457610-144457632 CCCATGGGGTCCCCTGAGGCTGG - Intergenic
967769703 3:193321237-193321259 CCCAGTAGATCCTAAGAAGCAGG - Intronic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
983252952 4:165365456-165365478 CCCATTGGGTGCTCTGAAGCTGG + Intronic
992293768 5:75306476-75306498 CCCTTTACTGCCCATGAAGCAGG + Intergenic
993482307 5:88438866-88438888 AGCATTAGGACCCATGAAACAGG - Intergenic
996069651 5:119120489-119120511 CCCATTTGATGCCATGAGGCAGG - Intronic
1002466215 5:179410165-179410187 CACATTAGGGCCCAGGAAGCTGG - Intergenic
1002930302 6:1629719-1629741 CCCATTAGGCACCATGCAGGAGG - Intronic
1004290376 6:14361608-14361630 TCCAATAGGTCCCAAGAAACAGG - Intergenic
1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG + Intergenic
1007841600 6:44720536-44720558 CCCATTAGCTCCCATGAGCAAGG - Intergenic
1012470875 6:99571056-99571078 CCCATAAAGTCCCATAAAGTCGG + Intergenic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1021769330 7:23983158-23983180 TCCATGAGGTCCCGTGAGGCAGG - Intergenic
1022863872 7:34397169-34397191 CTCATGAGGTCCCATAAAGGAGG + Intergenic
1034672452 7:152868970-152868992 CCCATCAGTTCCCAGGAAACAGG - Intergenic
1034971056 7:155419296-155419318 CCCATATGGACCCATGGAGCAGG + Intergenic
1044543145 8:93430181-93430203 TCTATTAATTCCCATGAAGCTGG + Intergenic
1049679412 8:143910996-143911018 ACCATGGGGGCCCATGAAGCTGG + Intergenic
1050268673 9:3918495-3918517 CCCATAAGGTACCATGAAGACGG - Intronic
1053434636 9:38067155-38067177 CCCATAAGGTCCCAGGAACACGG - Intronic
1055012016 9:71577535-71577557 CCCACTAGGTCTCATGAGGTAGG - Intergenic
1057310785 9:93941797-93941819 CCCAACAGGTTACATGAAGCGGG + Intergenic
1059446907 9:114343707-114343729 CCCATTAGGACCCAGGATGCGGG - Exonic
1061165318 9:128919004-128919026 CACATCCTGTCCCATGAAGCTGG - Intergenic
1062504240 9:136865330-136865352 CTCATGGGGTCCCCTGAAGCAGG + Intronic
1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG + Intergenic
1185488121 X:498533-498555 GCTATTAGGTCCCAGGACGCAGG + Intergenic
1185488150 X:498683-498705 GCTATTAGGTCCCAGGACGCAGG + Intergenic
1185488598 X:501346-501368 GCCATTAGGTCCCGGGACGCAGG + Intergenic
1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG + Intergenic
1187092934 X:16116538-16116560 GCCATTTTGTCCCATAAAGCTGG + Intergenic