ID: 1148780065

View in Genome Browser
Species Human (GRCh38)
Location 17:50116338-50116360
Sequence AACTATAAAACGTTCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148780063_1148780065 8 Left 1148780063 17:50116307-50116329 CCTAATGGGATGCTTATGACAGC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1148780065 17:50116338-50116360 AACTATAAAACGTTCCAAAAAGG 0: 1
1: 0
2: 3
3: 20
4: 251
1148780061_1148780065 22 Left 1148780061 17:50116293-50116315 CCTGCTTCATGGGACCTAATGGG 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1148780065 17:50116338-50116360 AACTATAAAACGTTCCAAAAAGG 0: 1
1: 0
2: 3
3: 20
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148780065 Original CRISPR AACTATAAAACGTTCCAAAA AGG Intronic
903457738 1:23499629-23499651 AACCATAAAAAGAACCAAAAGGG - Intergenic
904230111 1:29062475-29062497 AAATATAAAATGTTCTCAAAAGG - Intronic
907600429 1:55763369-55763391 ACCAATAACAAGTTCCAAAATGG + Intergenic
907960656 1:59277665-59277687 ATCTATAGCACGTTCAAAAAGGG - Intergenic
909139929 1:71850515-71850537 AAGCATAAAATGTTCCAAAAGGG - Intronic
909376247 1:74945340-74945362 AACTATCAAACGATGCAAAATGG + Intergenic
909762053 1:79301892-79301914 AACAATAAAATCTTTCAAAATGG + Intergenic
910432742 1:87175155-87175177 AACTATAAAATACTCCACAAAGG - Intergenic
910513493 1:88033787-88033809 AACTGTCAAACATTCCAAAGAGG - Intergenic
910701403 1:90078597-90078619 AACTATAAAACATTGATAAAAGG - Intergenic
912072807 1:105834143-105834165 AAAAATAAAACATTCCATAAAGG + Intergenic
913424714 1:118714505-118714527 AACTATAAAACATTGATAAAAGG - Intergenic
915577920 1:156793203-156793225 AACTATCAAACCTGCCAAGAAGG - Intronic
916712148 1:167420978-167421000 AAATTTAAAATTTTCCAAAATGG + Exonic
918475938 1:184925163-184925185 AACTATAAAAAGAGACAAAAGGG - Intronic
920097064 1:203493123-203493145 AAATTCACAACGTTCCAAAAAGG + Intergenic
921823406 1:219642986-219643008 AACAATAAAAAGTTTAAAAATGG + Intergenic
922319501 1:224473535-224473557 AACTATAAAAAGCGACAAAAAGG + Intronic
1064168815 10:13010879-13010901 ATCTATAAAACGGTCACAAAGGG + Intronic
1064456738 10:15494252-15494274 AACTATACCTCATTCCAAAAAGG + Intergenic
1065295172 10:24267407-24267429 ACCTAGAAAAAGTTACAAAACGG + Intronic
1066417473 10:35234421-35234443 AACTTTTAGAGGTTCCAAAAAGG - Intergenic
1067335566 10:45359988-45360010 AGCTAAAAAACCTTCAAAAAAGG + Intergenic
1070463169 10:76690309-76690331 AACAAAAAAACTTTTCAAAAAGG - Intergenic
1071372881 10:84971350-84971372 AACTATAAAACTTGACTAAATGG - Intergenic
1073825415 10:107315102-107315124 AACTGTAAACCATTCCAAATAGG - Intergenic
1076232132 10:128829480-128829502 AACCATAAATCGTGTCAAAATGG + Intergenic
1077828112 11:5832152-5832174 CACTATAAAATTTTCCATAAGGG - Intronic
1078148556 11:8739473-8739495 CACTATAAATCATTCCATAAAGG + Intronic
1079530324 11:21445076-21445098 AACAATAAGACGTTAAAAAATGG - Intronic
1079625791 11:22616184-22616206 AACAATAAAAAGTTAAAAAAGGG - Intergenic
1081624846 11:44647107-44647129 AACTTTAAAAAGTTGAAAAAAGG - Intergenic
1082907932 11:58332730-58332752 AACTATAAAAAGAGACAAAAAGG - Intergenic
1083836081 11:65268980-65269002 AACTATGAAACTATTCAAAAAGG - Intronic
1085078046 11:73609459-73609481 ATCTATTAAATGTTTCAAAATGG + Intergenic
1085712125 11:78839274-78839296 AACTATAACATGTTCCTAGATGG - Intronic
1085879522 11:80449301-80449323 AATTCTAAAATATTCCAAAAAGG - Intergenic
1086280846 11:85186570-85186592 AACTGTTAAAAGTTCCATAAAGG - Intronic
1091367532 11:135034880-135034902 AAGTATATAATCTTCCAAAAGGG + Intergenic
1092468076 12:8752646-8752668 AACTATAACACTTTACAAGATGG + Intronic
1093104386 12:15068508-15068530 AACTATAAAACATTTAAATAAGG - Intergenic
1093209150 12:16286789-16286811 AACTATAAAACACTGCTAAAAGG - Intergenic
1094385314 12:29887557-29887579 ATCTTTAAAGGGTTCCAAAAGGG - Intergenic
1094444263 12:30512521-30512543 AACTATAAAACGTTCCCACAAGG - Intergenic
1094689784 12:32757123-32757145 AACTTTATAACGTTAAAAAATGG - Intergenic
1097606214 12:61757751-61757773 AAGAATAAAAGGTTTCAAAAAGG + Intronic
1097949079 12:65406412-65406434 AACTATAAAACGTTCATGAAAGG + Intronic
1099829030 12:87816204-87816226 AACTAGAAAATGTTTCAAACAGG - Intergenic
1102582832 12:113901910-113901932 AACTATAAAGCATTAGAAAAAGG - Intronic
1103638960 12:122332813-122332835 AACTATTTAACCTTCTAAAATGG - Intronic
1103795505 12:123500240-123500262 AACTGTAAAAAGTGCCATAAAGG - Intronic
1105582250 13:21709764-21709786 CATTATAAAACATGCCAAAAAGG - Intergenic
1105697342 13:22901388-22901410 AAATATAAAAGGTTATAAAAAGG + Intergenic
1105745231 13:23371777-23371799 AACTATTAAAACTACCAAAAAGG + Intronic
1106968472 13:35104321-35104343 AAATATAAAACATGCCAGAATGG - Intronic
1107011624 13:35676106-35676128 AAATATAAAAAATTTCAAAAGGG - Intergenic
1108536539 13:51386607-51386629 AAGTACAAAAGGTTTCAAAAAGG + Intronic
1108906080 13:55475817-55475839 CACTGTAAAACTCTCCAAAAAGG - Intergenic
1108956196 13:56160956-56160978 AACTATAAAACGTTGATAAAAGG + Intergenic
1110416633 13:75260656-75260678 ATCTATAAAATGTTTAAAAATGG + Intergenic
1110441953 13:75536236-75536258 AACTAAAGAACGTTCAACAATGG + Intronic
1110625990 13:77656474-77656496 AACTATAAAACTTTGGTAAAAGG - Intergenic
1111272529 13:85905305-85905327 ATCTAAAAAACGTTTTAAAAAGG + Intergenic
1111794547 13:92901376-92901398 AGCTATAAAACATTCCAATTAGG - Intergenic
1111983842 13:95045328-95045350 GATTAAAAAACCTTCCAAAATGG - Intronic
1112281618 13:98067701-98067723 AAGTTTAAAACTTTGCAAAAAGG + Intergenic
1112652900 13:101417543-101417565 AACAATAAAACGTACTAATATGG - Intergenic
1112717156 13:102200297-102200319 AACTATAAAATGCTCTAAAGAGG + Intronic
1112819724 13:103317843-103317865 AACTTTAAAATGTTTTAAAATGG - Intergenic
1114926326 14:27404043-27404065 AACTACAAAATTTTACAAAAGGG + Intergenic
1115476970 14:33824618-33824640 AACTATAAAAAGAGACAAAAAGG + Intergenic
1116581954 14:46653328-46653350 AAGTGTAAAATGTGCCAAAAAGG + Intergenic
1116614810 14:47121302-47121324 AAATATAGAATATTCCAAAAAGG + Intronic
1117915570 14:60674710-60674732 AACTCTAAAACTTTCCTGAAGGG - Intergenic
1118411767 14:65487001-65487023 AACTATGTAATGTTCCAGAAGGG - Intronic
1120458979 14:84769095-84769117 ATCAATAAAACCTTCCCAAATGG + Intergenic
1121072984 14:91041993-91042015 AAATATAAAACACTTCAAAAAGG + Intronic
1121186568 14:91977354-91977376 AACTATAAAACGCTTAAAACAGG - Intronic
1126261305 15:46695782-46695804 AACTGAAAAAGGTTGCAAAATGG - Intergenic
1126479153 15:49098678-49098700 AACTATAAAAAATTTCCAAAAGG - Intergenic
1127131037 15:55864230-55864252 AACTTTAAAATGCTCCCAAAAGG + Intronic
1128889001 15:71314143-71314165 AACTATTAAACCTTTAAAAAAGG - Intronic
1130262624 15:82369828-82369850 TATTATAAAACGTACAAAAAAGG - Intergenic
1130278605 15:82499119-82499141 TATTATAAAACGTACAAAAAAGG + Intergenic
1130834552 15:87636501-87636523 GACTATAAAAGCTTTCAAAAGGG - Intergenic
1131186828 15:90281418-90281440 AACTCTAAAAAGTTCCAGGAGGG + Intronic
1131501466 15:92971336-92971358 AAATCTAAAATGTTCCAAAATGG - Intronic
1131503303 15:92991969-92991991 GACTATAAAAACTTCCAAAAGGG + Intronic
1139030115 16:62869718-62869740 AACAAGAAACCTTTCCAAAAAGG - Intergenic
1139581315 16:67875480-67875502 AACCATAAAGAGTTTCAAAAGGG - Intronic
1141182475 16:81763663-81763685 AGCTATAAAAAGTTACAAAGGGG + Intronic
1141508005 16:84492301-84492323 AATTATAAAAGGTTATAAAAAGG + Intronic
1145821809 17:27843183-27843205 AATTATAAAAGGTTATAAAAGGG + Intronic
1148780065 17:50116338-50116360 AACTATAAAACGTTCCAAAAAGG + Intronic
1149022178 17:51981094-51981116 AACTATCAGAACTTCCAAAATGG - Intronic
1149055900 17:52364925-52364947 AAGAATAAAACGTTCAGAAATGG + Intergenic
1149464204 17:56861822-56861844 AACTATAATACCTTCCAAGCTGG - Exonic
1149504226 17:57180209-57180231 AACTATAAAACATTGCCAAGAGG - Intergenic
1150947051 17:69759038-69759060 AACTATGTAACATTCTAAAAAGG - Intergenic
1151407038 17:73894993-73895015 AACTAAAAAATGTAACAAAAAGG - Intergenic
1153410961 18:4792032-4792054 AATTCTAAAGCGTTACAAAATGG + Intergenic
1156705963 18:39882720-39882742 AACTATAAAATATTCAATAATGG - Intergenic
1156906536 18:42359471-42359493 CATTATAAGAAGTTCCAAAAAGG + Intergenic
1159457008 18:68671522-68671544 AACAACAAAAAGATCCAAAAAGG - Intergenic
1165619915 19:37237088-37237110 AATTAAAAAACGTTCCATAAAGG - Intronic
929312094 2:40437172-40437194 AACTATAACGATTTCCAAAATGG + Intronic
930046602 2:47177832-47177854 CTCTATAAGAGGTTCCAAAAAGG + Intergenic
931343280 2:61423513-61423535 AACTACAAAATGTTGCTAAAAGG + Intronic
932927685 2:75995383-75995405 TATTATAAAACTTTCCAGAAAGG + Intergenic
932957430 2:76370049-76370071 AAATATAAAACATTTCATAATGG - Intergenic
933283648 2:80360055-80360077 AACTACAAAACTTTGCTAAAAGG - Intronic
934877213 2:97934903-97934925 AACTATAAAACTTTTTAAAAAGG + Intronic
936880002 2:117238741-117238763 AACTATAAAACATTGCTGAAAGG + Intergenic
937722287 2:125115659-125115681 AACTATAAAATATTTTAAAAAGG + Intergenic
938180471 2:129177911-129177933 AACTCTAAAACGATAAAAAATGG + Intergenic
938741873 2:134239769-134239791 AATTATGATATGTTCCAAAAAGG + Intronic
939228435 2:139394205-139394227 AATTATAAATTTTTCCAAAATGG + Intergenic
939868446 2:147501527-147501549 AAAAATAAAGAGTTCCAAAAAGG + Intergenic
941268853 2:163400041-163400063 AAGTAAAGAATGTTCCAAAATGG + Intergenic
941484425 2:166061348-166061370 AAACACAAAAGGTTCCAAAAAGG + Intronic
941514542 2:166456390-166456412 AACTATTTAAAATTCCAAAAAGG + Intronic
942099454 2:172564965-172564987 AACAATAAAGCTATCCAAAAAGG - Exonic
942904095 2:181160138-181160160 AACTGTAAAACCTTCCAAAATGG - Intergenic
943938741 2:193962255-193962277 AGCTGAAAAACGTTTCAAAAAGG + Intergenic
944142448 2:196472181-196472203 AAGTTTAAAACGTTCAAAACAGG + Intronic
944198253 2:197077809-197077831 AATTATAAAACATTCAAAAACGG - Intronic
945446737 2:209947151-209947173 ATCTACAAAAAGTTCCAGAATGG + Intronic
946398061 2:219453215-219453237 AACCATAAAAGGCTCCCAAATGG - Intronic
1169552669 20:6717164-6717186 AACTGGAACACCTTCCAAAAAGG + Intergenic
1169824647 20:9754035-9754057 AAGTATCAAACTTTGCAAAAAGG - Intronic
1170335100 20:15261302-15261324 AATTAGAAAACATTTCAAAAGGG + Intronic
1176669676 21:9721362-9721384 CACTATAAACCCATCCAAAAAGG + Intergenic
1177060373 21:16366225-16366247 AAATATAAAACTCCCCAAAAAGG + Intergenic
1178169870 21:30028287-30028309 AAATATAAAATGTTCCAGATTGG - Intergenic
1178500598 21:33122893-33122915 AACTGTAAAGATTTCCAAAATGG - Intergenic
1179305495 21:40150255-40150277 AACTAACAAACTTTGCAAAAGGG - Intronic
1179356092 21:40661526-40661548 AATTATAAAACCTTTCAAATAGG - Intronic
1183841845 22:40504772-40504794 AATTATGAAACATTCCAAATTGG + Intronic
949781744 3:7697266-7697288 AACTATAAAATGTTACATAAGGG - Intronic
950972069 3:17199060-17199082 AACTATAAAACGTTTAAATGCGG - Intronic
951770838 3:26255890-26255912 AACTATAAAACATTGATAAAAGG - Intergenic
951986241 3:28624506-28624528 TACTAAAAACTGTTCCAAAATGG - Intergenic
952516301 3:34107598-34107620 AAATATAAAATGTTCCACTAAGG + Intergenic
952583234 3:34860114-34860136 AACTTAAAAACTTGCCAAAAAGG + Intergenic
952666740 3:35915949-35915971 AAATAAAAAACATTTCAAAAGGG - Intergenic
954641690 3:52103914-52103936 AACTGTCAAACTTTTCAAAATGG - Intronic
955148386 3:56342740-56342762 AATTAAAAATTGTTCCAAAAAGG - Intronic
957150431 3:76479237-76479259 AATTCTATAACGTTACAAAATGG + Intronic
957438002 3:80204503-80204525 GACTTTAAAACATTTCAAAAGGG + Intergenic
957929596 3:86861742-86861764 AAATATAAAACTTACCATAAAGG - Intergenic
958869572 3:99541685-99541707 AGCTATAAAATGTTACATAAAGG - Intergenic
959300405 3:104592329-104592351 AAATATAAAACACTCAAAAACGG - Intergenic
959303245 3:104629307-104629329 TGCTATATAATGTTCCAAAAAGG + Intergenic
959432762 3:106275261-106275283 AAGTAAAAAATGTTTCAAAATGG - Intergenic
961388735 3:126539280-126539302 AAATAAAAAACGTTTCACAAAGG - Intronic
962260860 3:133904126-133904148 AACCATAACACTTTCCCAAAAGG - Intergenic
962621646 3:137186190-137186212 AATTCTATAACCTTCCAAAAGGG + Intergenic
964347429 3:155768559-155768581 AAATTTATAACTTTCCAAAAAGG + Intronic
965073711 3:163949970-163949992 AACAATAAAAGGTTGAAAAATGG + Intergenic
965448872 3:168811763-168811785 ACCTATAAAAAGTTCAAAAAAGG + Intergenic
965764894 3:172120008-172120030 CACTACAAAAGCTTCCAAAAAGG + Intronic
966188956 3:177254016-177254038 AACTATAAAACATTGCTGAAAGG - Intergenic
968023749 3:195420119-195420141 AACTATAAAACTTGACAGAAAGG - Intronic
970552006 4:17191053-17191075 AACTCTAAAAGGTCTCAAAATGG + Intergenic
970665341 4:18330167-18330189 AGCAATAACACTTTCCAAAAAGG - Intergenic
970883321 4:20957720-20957742 AACTATAATAGTATCCAAAATGG - Intronic
971016273 4:22492321-22492343 AACTATTAAAAGTTCCAACCAGG - Intronic
971568763 4:28182690-28182712 AATTATAAAACGTTGACAAAAGG - Intergenic
972843735 4:42962281-42962303 AACAATTAAATGTTCCAGAATGG - Intronic
974813631 4:66977957-66977979 AACAATAGCACTTTCCAAAAAGG + Intergenic
974865315 4:67573011-67573033 CACTTTAAAAAGTTCCCAAAAGG - Intronic
975892456 4:79045895-79045917 AAATGTAAAAGGTTCCAAATAGG + Intergenic
976564336 4:86536487-86536509 AATTTTAAAACTTTCCAAATGGG + Intronic
977236490 4:94513692-94513714 AAAGATACAACGTTCCAAACTGG - Intronic
977463296 4:97353275-97353297 CAGTATAAAATGTTCAAAAATGG - Intronic
978247129 4:106586875-106586897 TATTATATAACTTTCCAAAAGGG - Intergenic
978311089 4:107385697-107385719 ATCTATAAAGCGTTTCATAAAGG - Intergenic
978573138 4:110162085-110162107 AAATTTAAAATGTTCCACAAGGG - Intronic
979550345 4:121983971-121983993 AACTATAAAATGTTGCAAAGTGG - Intergenic
979861854 4:125703750-125703772 AATTATAAAATGTTCTAACATGG + Intergenic
980478040 4:133345722-133345744 TATTAGAAAATGTTCCAAAATGG + Intergenic
981802518 4:148674749-148674771 AACTATATGACTTTCTAAAAAGG - Intergenic
982544550 4:156717705-156717727 AACAATAAAACCCTCCAAAATGG + Intergenic
982600368 4:157442056-157442078 AACAATAAATCTTTACAAAAAGG + Intergenic
983684591 4:170393411-170393433 AATTTAAAAAGGTTCCAAAATGG + Intergenic
984047975 4:174826334-174826356 AATTATATAAAGTTCTAAAATGG + Intronic
985405103 4:189630108-189630130 CACTATAAACCCATCCAAAAAGG - Intergenic
987280513 5:16409303-16409325 AAGTATCAAAAGATCCAAAAAGG + Intergenic
987945503 5:24603353-24603375 AACGATAAAACATTACAAAGAGG + Intronic
988440755 5:31229522-31229544 ACCTATAAAAGCTTCCAAATTGG - Intronic
988988888 5:36649950-36649972 AATTATAATACGTTCCATCATGG + Intronic
989310067 5:40005375-40005397 AAATATACAACCTACCAAAATGG - Intergenic
991150585 5:63363262-63363284 AACTATAAAACACTCAAATAGGG + Intergenic
993047999 5:82890471-82890493 AAATATAAAACACTACAAAAGGG + Intergenic
994386138 5:99134860-99134882 AACTAAAAAACAACCCAAAAAGG - Intergenic
995153325 5:108878273-108878295 ATCTATAAAATCTTACAAAAAGG + Intronic
995264568 5:110143103-110143125 AACTTTAAAACCTTCTAAGAGGG + Intergenic
995653597 5:114399772-114399794 ACCAATAACAAGTTCCAAAATGG - Intronic
997712401 5:136016890-136016912 AACTTTAAAATGTGCAAAAAAGG + Intergenic
997846401 5:137290369-137290391 ATCTATATAAAGTTCAAAAAAGG + Intronic
998732159 5:145090886-145090908 ATCAATAACAAGTTCCAAAATGG - Intergenic
999628846 5:153548693-153548715 AACTATAAAATGTGAGAAAAAGG + Intronic
1000231525 5:159319865-159319887 GAATATAAACCCTTCCAAAATGG - Intronic
1002880691 6:1249394-1249416 CACTATACAGCTTTCCAAAATGG + Intergenic
1003348713 6:5295493-5295515 AATAATAAAACGTTTTAAAAAGG + Intronic
1003671319 6:8163098-8163120 AACAATAACACTTTACAAAAAGG - Intergenic
1004864771 6:19842113-19842135 AATTTTAAAAAGTTCTAAAAAGG - Intergenic
1005406374 6:25492307-25492329 ACCTATAAAAGTTTCTAAAAGGG - Intronic
1005701057 6:28400461-28400483 AGCTTTAAAACATTCCTAAAAGG + Intergenic
1005811858 6:29522240-29522262 AATTATAAAATGTTACAAAAAGG - Intergenic
1006216447 6:32447694-32447716 AACTAGAATATCTTCCAAAATGG + Intergenic
1006880818 6:37338012-37338034 AACTATAAAAAGAACCAAATGGG - Intergenic
1007535566 6:42584689-42584711 AACTATAAGACTTTGCTAAAAGG - Intronic
1008340291 6:50356511-50356533 AACTAGAAAATGATACAAAAGGG + Intergenic
1010548947 6:77196194-77196216 ATATATAAAACCTTTCAAAATGG + Intergenic
1011238931 6:85249740-85249762 ACCAATAACAAGTTCCAAAATGG - Intergenic
1012728759 6:102852190-102852212 AACACTAAAACATTCCAAAATGG + Intergenic
1012808227 6:103923047-103923069 AACTATAAAAAGTGCTCAAATGG + Intergenic
1013821742 6:114162283-114162305 AACTATAAAAGTTTCCAAATAGG + Intronic
1017340507 6:153316266-153316288 AAGTATAAAATGTTAGAAAATGG + Intergenic
1020855322 7:13414279-13414301 AAAAATAAAAGGGTCCAAAAGGG - Intergenic
1021766590 7:23956072-23956094 AAAAAAAAAAAGTTCCAAAATGG - Intergenic
1022159053 7:27690595-27690617 AATTGTAAAACATCCCAAAAAGG - Intergenic
1022354846 7:29604013-29604035 CACTATAAAACATTCAAATAGGG - Intergenic
1023418526 7:39953327-39953349 AACTATAATACTTTGCCAAAGGG + Intronic
1026061040 7:67026420-67026442 AACTTTAAAACATTCCTGAATGG + Intronic
1027524338 7:79247687-79247709 AACCACAAAAAGTTCAAAAATGG + Intronic
1029893930 7:103961402-103961424 AAATATAAATGATTCCAAAAGGG - Intronic
1031281673 7:119810537-119810559 TAATATAAAACCTTCTAAAAAGG - Intergenic
1031637134 7:124115496-124115518 AACTATAAAACATTAATAAAAGG + Intergenic
1031652979 7:124314675-124314697 AATTCTAAATCATTCCAAAAAGG + Intergenic
1031891533 7:127299526-127299548 ACCAATAACAAGTTCCAAAATGG + Intergenic
1037017207 8:13923716-13923738 AACTATAAGACATTCTAAAAAGG - Intergenic
1037204418 8:16297033-16297055 AGGTATAAAACATTGCAAAAGGG - Intronic
1037236405 8:16724760-16724782 TACTATAAATCCATCCAAAAGGG - Intergenic
1038216825 8:25569297-25569319 AACTACAGTACGTTCCAAAGGGG + Intergenic
1038221799 8:25615463-25615485 AACTATTAGAGGTTCCAAGATGG - Intergenic
1039949454 8:42157159-42157181 AACTATAAAGCACTACAAAATGG - Intronic
1040623684 8:49119435-49119457 AACTATAAAACTTTAAAAATAGG - Intergenic
1041648253 8:60275818-60275840 CACTGTAAAAGGTTCCAGAAAGG + Intronic
1042623352 8:70730363-70730385 AACTGTAAAGGGTTCTAAAAAGG - Intronic
1043399002 8:79865353-79865375 AACAATAAAAAATTCCAAAGGGG + Intergenic
1044694611 8:94910126-94910148 AACAAAAAAAAGTTCCTAAATGG - Intronic
1045471471 8:102516099-102516121 AACTATATAAAGTTCAAAATGGG - Intergenic
1045793011 8:106008309-106008331 AACTATAAATAGTTTCAAATTGG - Intergenic
1046267628 8:111851576-111851598 AAATATAAAATGTTGCAGAATGG - Intergenic
1046402942 8:113730981-113731003 AAATGTGAAACTTTCCAAAAAGG + Intergenic
1050071965 9:1824622-1824644 AAGTAGAAAACGCTACAAAATGG - Intergenic
1050875868 9:10635231-10635253 AACTATGAAACTTTACAAAAGGG - Intergenic
1051134497 9:13903187-13903209 AACTTTAAAATTTTCCAGAAAGG - Intergenic
1051520470 9:17981637-17981659 AAGTATAAAAGGTTTCTAAAGGG - Intergenic
1052621117 9:30911481-30911503 ATCTTTAAAAAGTTCCAAGAAGG + Intergenic
1053403305 9:37847961-37847983 ATCTATAAAACATTGCTAAAGGG + Intronic
1055645229 9:78356685-78356707 ATCCACAAAACCTTCCAAAACGG - Intergenic
1056153167 9:83808214-83808236 AACAAGAAAATGTTTCAAAATGG + Intronic
1056787184 9:89601804-89601826 AACTATAAACATTTCCAAAAAGG + Intergenic
1058517495 9:105791202-105791224 AACAATAAAGGGTTCCAAGATGG - Intergenic
1059526702 9:114998286-114998308 AACTATAAAAGATTTAAAAATGG - Intergenic
1060287373 9:122265592-122265614 AACTATAAAGCTTTCCAAAATGG - Intronic
1060362142 9:122969589-122969611 AACGATACAAGGTTTCAAAAAGG - Intronic
1060385474 9:123223140-123223162 AACTATATGACATTCCAGAAAGG + Intronic
1061111927 9:128579027-128579049 AACTATAAAACTTTGTTAAAAGG + Intronic
1186133987 X:6499324-6499346 AATTATAAAATGTGCCAAGAAGG + Intergenic
1186513368 X:10147967-10147989 AACTATAAAGCATTCCTGAAAGG - Intergenic
1187906085 X:24067887-24067909 ACCTATCAAAAGTTCCAACAGGG - Intronic
1192700550 X:73466558-73466580 AGCAATAAAAAGTTCAAAAATGG + Intergenic
1193818314 X:86129807-86129829 AACAATAAAACGTTCAAAATAGG - Intergenic
1194589617 X:95783169-95783191 AACTATTACATGTTTCAAAATGG - Intergenic
1194695840 X:97048790-97048812 AACTATAAACCATTGAAAAATGG - Intronic
1195534786 X:105998954-105998976 AACTATTTAACGTTGCAAACTGG - Intergenic
1195944119 X:110191028-110191050 AACTATAAAATGTTGCAACTGGG - Intergenic
1197091566 X:122544866-122544888 AACTAGAAAACATTCAGAAAAGG + Intergenic
1197566320 X:128092294-128092316 AATTATAAAACATACTAAAATGG - Intergenic
1199320219 X:146429090-146429112 ATCCTTGAAACGTTCCAAAATGG + Intergenic
1199460205 X:148075662-148075684 AACTAAAACACGTGGCAAAAGGG + Intergenic