ID: 1148780066

View in Genome Browser
Species Human (GRCh38)
Location 17:50116342-50116364
Sequence ATAAAACGTTCCAAAAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148780063_1148780066 12 Left 1148780063 17:50116307-50116329 CCTAATGGGATGCTTATGACAGC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1148780066 17:50116342-50116364 ATAAAACGTTCCAAAAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 187
1148780064_1148780066 -10 Left 1148780064 17:50116329-50116351 CCTTTTACAAACTATAAAACGTT 0: 1
1: 0
2: 0
3: 22
4: 296
Right 1148780066 17:50116342-50116364 ATAAAACGTTCCAAAAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 187
1148780061_1148780066 26 Left 1148780061 17:50116293-50116315 CCTGCTTCATGGGACCTAATGGG 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1148780066 17:50116342-50116364 ATAAAACGTTCCAAAAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148780066 Original CRISPR ATAAAACGTTCCAAAAAGGT AGG Intronic
902316855 1:15627182-15627204 ATAAAATGCTCCAGAAAGGCTGG - Intronic
908927595 1:69274884-69274906 ATTAACCTTTCCAAAAAGGTAGG + Intergenic
909274894 1:73670848-73670870 ATAAAACATTACAAAAACATAGG + Intergenic
910030707 1:82718762-82718784 ATAGAAAGTTCCAATAAGCTAGG + Intergenic
912095059 1:106129601-106129623 ATTAAACGTTCCTAATATGTTGG + Intergenic
918085965 1:181245505-181245527 ATAAAACCTACCACAAAGTTTGG + Intergenic
919207812 1:194439592-194439614 GCAAAACCTTCCAAAAACGTTGG + Intergenic
919568311 1:199217233-199217255 ATAAAACCTCCCAAAAATATGGG - Intergenic
919865370 1:201778225-201778247 ATTAAACTTTCCATAAATGTGGG + Intronic
920673418 1:208022385-208022407 TTAAAATGTTCCAATAAAGTGGG - Exonic
920714637 1:208328069-208328091 AGAGAATATTCCAAAAAGGTGGG - Intergenic
921570128 1:216767987-216768009 ATAAAACATACCAACAATGTGGG - Intronic
923324499 1:232869336-232869358 ATAAAACAGCCAAAAAAGGTGGG - Intergenic
924390030 1:243544451-243544473 ACAAAAAGTACCAAAAACGTAGG + Intronic
924704270 1:246486904-246486926 ATAACACTGTTCAAAAAGGTAGG + Intronic
1063771647 10:9210083-9210105 ATAAAAAGTGCTGAAAAGGTAGG - Intergenic
1065804331 10:29380955-29380977 AATAAACGTTGCAAAAATGTTGG + Intergenic
1065982689 10:30916747-30916769 ATAATATGTTCCAGAAAGCTGGG - Intronic
1066384730 10:34932497-34932519 AAAAAAAATTCCAAACAGGTAGG - Intergenic
1070109349 10:73468142-73468164 GTAAAATGTTCCAAATGGGTGGG - Intronic
1070897513 10:79997309-79997331 AGAAAAAGTTCCCAAAATGTTGG + Intergenic
1072007353 10:91265982-91266004 ATAAAATGTTACAGAAAGGCAGG - Intronic
1072778517 10:98225832-98225854 AAAAAAAGTTACAAAAAGGAAGG - Intronic
1074235037 10:111576535-111576557 GTAAAACTATCCAAATAGGTGGG - Intergenic
1075432112 10:122394369-122394391 ATAAAAAGTTCCAAAAGGCCGGG - Intronic
1077626410 11:3775845-3775867 AAAAAACATTCCACAAAGATTGG + Intronic
1079643098 11:22830682-22830704 TTCAAACATTACAAAAAGGTAGG + Intergenic
1079845059 11:25455236-25455258 ATAAAACATTTCCAAATGGTAGG + Intergenic
1080224618 11:29946634-29946656 ATAAAATGTTCCATAAAGTTTGG + Intergenic
1082203724 11:49405517-49405539 TTCAAACGTTCCAACAAGGGGGG - Intergenic
1088778985 11:113115237-113115259 ATAAAACGTACAAAACAGCTTGG + Intronic
1089137574 11:116262119-116262141 ATAATATGTTCCTAAAAGGCGGG - Intergenic
1090443489 11:126744066-126744088 AGAAAATGTTCCAGAAAGTTGGG + Intronic
1091888876 12:4036943-4036965 ATAAAGCTTTCCAAAAAAATGGG - Intergenic
1093675302 12:21931933-21931955 ATAAAACATTACAAAATAGTTGG + Intronic
1094335258 12:29343272-29343294 ATGATACGTTCCTAAAAGGGAGG + Exonic
1095694549 12:45129771-45129793 ATAAAACATTCATAAAATGTAGG - Intergenic
1096347257 12:50860574-50860596 ATAATACGTTTTAAAAAGCTGGG - Intronic
1097744611 12:63287421-63287443 AAAAAAAGTTCCTAAAAGATAGG + Intergenic
1099340638 12:81428794-81428816 ATAATACGTTCCCAATAAGTGGG + Intronic
1099457284 12:82879284-82879306 ATGAAACCGGCCAAAAAGGTTGG - Intronic
1099678583 12:85794199-85794221 TTAAAGCATTCCAAAAAGTTAGG + Intergenic
1102459644 12:113092746-113092768 ATAAAACGTTCCAGGAAAGAAGG - Intronic
1102729849 12:115098799-115098821 TTAAAACATTCAAAAAAGATTGG + Intergenic
1106282536 13:28288663-28288685 ATAAAACATTGCATAAAGGAGGG - Intronic
1107775508 13:43836552-43836574 ATAAAAAGTTCGAAACAGGCCGG + Exonic
1109218277 13:59615093-59615115 ATAAAACCATCCCAAAAGATGGG + Intergenic
1109455394 13:62581577-62581599 AAAAAATGTTGCAAAAATGTTGG + Intergenic
1111341310 13:86890309-86890331 ATAAAACTTTCAAAACCGGTGGG - Intergenic
1114239440 14:20852717-20852739 ATAAAATCTCTCAAAAAGGTGGG + Intergenic
1114832136 14:26157362-26157384 ATAAAACCTCGCAAAAATGTGGG - Intergenic
1114972975 14:28057194-28057216 AGAAAAGTTTCAAAAAAGGTTGG + Intergenic
1115035916 14:28856422-28856444 TTAAAACGTACCTAAATGGTGGG + Intergenic
1115837278 14:37421559-37421581 ATAAAACATTCTAAAAAACTAGG - Intronic
1116099842 14:40419838-40419860 ATAAAATGTTTCAGAAAGATAGG + Intergenic
1116221128 14:42088863-42088885 ATAAAATGTTGCAAAATGATAGG + Intergenic
1117547915 14:56808508-56808530 AAGAAACGTGCCAAAAGGGTTGG + Intronic
1117603843 14:57404561-57404583 ATACAACGTGCTAGAAAGGTAGG - Intronic
1119767748 14:77201023-77201045 ATAAAATGTTCCCAATAGGCTGG + Intronic
1120714677 14:87827859-87827881 ATAAAACTTTCAGAAAAGGCTGG - Intergenic
1123849287 15:24338175-24338197 ATAAAACCATGCAAAAAGTTAGG - Intergenic
1125053410 15:35328692-35328714 ATGAATTGTTCCAAATAGGTAGG + Intronic
1125307631 15:38338474-38338496 ATAAAACATTGGAAAAATGTTGG - Intronic
1128860114 15:71062880-71062902 ATAAAACGTTTCAACAAACTAGG - Intergenic
1131663289 15:94541818-94541840 ATAAAACTTTTAAAAAAGGGGGG - Intergenic
1132211433 15:100025907-100025929 ATAAAACTATCAAAAATGGTTGG - Intronic
1135811361 16:25589607-25589629 ATAAACCATTCCAACAAGCTAGG + Intergenic
1139142533 16:64285370-64285392 TTAAAATATTCCAAAAATGTAGG + Intergenic
1139642300 16:68301011-68301033 AAAAAACGTTGAAAAAAGGAAGG - Exonic
1140572683 16:76127104-76127126 ATAAAAATTTCAAAACAGGTTGG + Intergenic
1148780066 17:50116342-50116364 ATAAAACGTTCCAAAAAGGTAGG + Intronic
1149955188 17:61041201-61041223 ATAAAAAGTTTCATAAAGCTTGG + Intronic
1153171208 18:2318081-2318103 ATAAAAGTTAGCAAAAAGGTGGG - Intergenic
1153196690 18:2606807-2606829 ATAAATCTCTACAAAAAGGTAGG - Intronic
1155657598 18:28209964-28209986 AAAAAACGATCCTTAAAGGTAGG - Intergenic
1155973671 18:32105457-32105479 ATAAAAAGTTCCAAAACGTGTGG - Intronic
1156775555 18:40783819-40783841 ATGAAATGTTCAAAAAATGTAGG - Intergenic
1157843671 18:50982483-50982505 ATCAAACGTTTAAAATAGGTGGG + Intronic
1158225574 18:55197766-55197788 ATAAAACGTGCTAAAGAGTTGGG - Intergenic
1158474725 18:57769898-57769920 ATACAAGGATCCAATAAGGTAGG + Intronic
1158823145 18:61184389-61184411 ATAAAAAGTGCCAAATAGGGAGG - Intergenic
1158839484 18:61368871-61368893 AAAAAAAGTTCCAAATAAGTTGG + Intronic
1163133871 19:15295044-15295066 ATAAAAGGTTCCATAAAAGGGGG + Intronic
1164422163 19:28103902-28103924 ATAAAATGTGCCAAAAAAGAGGG + Intergenic
1164487150 19:28668270-28668292 AAAAAAAGTTCTAAAAATGTGGG + Intergenic
1167531993 19:50023716-50023738 AGAAAATGTGCCAAGAAGGTGGG + Intronic
1167895858 19:52580237-52580259 ATAAAAATTTCTAAAAAGGCTGG - Intronic
1168273627 19:55264331-55264353 ATATAACGTCCCAAGGAGGTGGG + Intronic
925918960 2:8626259-8626281 AGAAAGCGTTCCAAAGAGGAAGG + Intergenic
926027433 2:9556750-9556772 ATAAAACAGTCTAAAAACGTTGG + Intergenic
926376186 2:12230208-12230230 ATAGAACTTTCCACAATGGTGGG + Intergenic
926518205 2:13876449-13876471 TAAAAACGTTCCAAAATCGTGGG + Intergenic
927546501 2:23958806-23958828 ATAAAACCTTTCAGATAGGTAGG - Intronic
928668849 2:33579726-33579748 ATTAAACCATCCAAAAAGGGAGG - Intergenic
928670326 2:33597570-33597592 ATAAAAAGTTAAAAAAAGGAGGG + Intronic
930984729 2:57571242-57571264 ATGAAAAGTTCCAAATAAGTGGG - Intergenic
933010651 2:77058068-77058090 ATGAAATGTTCCCATAAGGTGGG - Intronic
934721741 2:96582741-96582763 ATCATATGTTCCAAAAATGTTGG + Intergenic
936361562 2:111808376-111808398 ATAAAGATTTCCAAAAAGTTTGG + Intronic
939282078 2:140076681-140076703 ATAAAACATGCCAAAAAGAATGG + Intergenic
939288015 2:140157396-140157418 ATGAAAGATTCCAAAGAGGTGGG - Intergenic
939412438 2:141846441-141846463 ATAACCTGTTCCAAAAATGTCGG - Intronic
942218669 2:173747835-173747857 AGAAAAAGTTCAAAAAAGGCCGG + Intergenic
942840390 2:180353235-180353257 TTAAAACTTACCAAAATGGTAGG + Intergenic
944142449 2:196472185-196472207 TTAAAACGTTCAAAACAGGCTGG + Intronic
945005540 2:205401271-205401293 ATAAAAATTTCCAGAAAGGGAGG - Intronic
945915559 2:215700577-215700599 ATAAAATGCTCCAAAAAGTAAGG + Intergenic
946088777 2:217200852-217200874 AGAACATTTTCCAAAAAGGTAGG + Intergenic
1169994850 20:11545276-11545298 GTAAAACACTCCAAATAGGTTGG - Intergenic
1177805317 21:25869323-25869345 AAAAAAAATTCCAGAAAGGTCGG - Intergenic
1181895023 22:26099650-26099672 TTGAAAAGTTCAAAAAAGGTTGG - Intergenic
950285060 3:11738379-11738401 ATACAACTTTCCTAAAAGATGGG - Intergenic
951658956 3:25040771-25040793 ATAAAATGTTCTACAAAGTTTGG - Intergenic
952276095 3:31878485-31878507 ATAAAACAATCCAAAAACCTCGG - Intronic
952412055 3:33058129-33058151 ATAAAACATTCCTGAAATGTGGG - Exonic
953428390 3:42815579-42815601 TTAAAACTTGCCTAAAAGGTAGG + Intronic
955316149 3:57940834-57940856 ATAAAATGTTCCAGAAATTTTGG + Intergenic
955758217 3:62248966-62248988 ATAAAATATGCCAACAAGGTTGG - Intronic
957863869 3:85996756-85996778 AAACAAGTTTCCAAAAAGGTTGG - Intronic
959913445 3:111791033-111791055 ATAAAACATTACCAAAAGTTAGG - Intronic
960105871 3:113796437-113796459 ATCCAAGGTTCAAAAAAGGTGGG - Intronic
961388733 3:126539276-126539298 AAAAAACGTTTCACAAAGGGTGG - Intronic
961580804 3:127880461-127880483 AAAAATTGTGCCAAAAAGGTTGG - Intergenic
964967292 3:162511770-162511792 ATAAAACGTTCCCAGAGGGAGGG - Intergenic
965660758 3:171039555-171039577 ATAGAACTTTCCAAAAATGTTGG + Intergenic
965806727 3:172549843-172549865 ATAAAACGTAACAAGAAGGCCGG - Intergenic
967468478 3:189835613-189835635 TTAAAATGTTCCAAAAAAGTGGG + Intronic
971562204 4:28093930-28093952 AGATAACTTTCCCAAAAGGTGGG + Intergenic
972917467 4:43898586-43898608 ATAAAAGCTACAAAAAAGGTAGG + Intergenic
974234040 4:59157661-59157683 ATAAACCACTCCAAAAAGTTTGG + Intergenic
975052660 4:69884605-69884627 ATAAAAATACCCAAAAAGGTGGG - Intergenic
975287988 4:72642696-72642718 ATCAAAACTTCCAAATAGGTTGG - Intergenic
976271656 4:83236731-83236753 ATAAAACGTCTCAACAAGTTAGG + Intergenic
978472667 4:109087116-109087138 ACAAAATGTTCCAAGAAGATAGG + Intronic
979118642 4:116863303-116863325 CTAAAACATTTCAACAAGGTTGG - Intergenic
980079535 4:128329417-128329439 ATAAAATGGTCAAAAGAGGTGGG + Intergenic
981957490 4:150496101-150496123 ATAAAACTTTTAAAAAAGATAGG - Intronic
982941547 4:161563848-161563870 AGAAAACTTTCAAAACAGGTTGG - Intronic
983158014 4:164376060-164376082 ATAAAAAGCTCCAAAGAGGCAGG + Intronic
984799144 4:183696937-183696959 ATCAGACGTTCCACAAAGCTAGG - Intronic
986520776 5:8615643-8615665 AGAAAACGTCACAGAAAGGTTGG + Intergenic
990620313 5:57551853-57551875 ATCAAACGTATCAAAAAGTTTGG - Intergenic
991445283 5:66693319-66693341 ATAAAATATTCCAAAAAGTGTGG + Intronic
991612629 5:68464954-68464976 AGAGAAGGTTCCAAAGAGGTGGG + Intergenic
991628827 5:68633354-68633376 ATAAAATGTATAAAAAAGGTAGG - Intergenic
992306058 5:75439347-75439369 ATAAAACATAGTAAAAAGGTTGG + Intronic
995012924 5:107277869-107277891 TTAAAACATTCCCAAAGGGTTGG + Intergenic
995874255 5:116774021-116774043 ACAATACTTTACAAAAAGGTCGG + Intergenic
996507039 5:124278969-124278991 ATAAAATGTTCCTAATTGGTAGG + Intergenic
998219116 5:140261670-140261692 ATAAAGCTTTCCAAAAACCTTGG + Intronic
1000287244 5:159837300-159837322 TAAAAGCGTTCCAACAAGGTAGG - Intergenic
1004096719 6:12562278-12562300 ATAAAACGTAACACAAAGGCTGG + Intergenic
1009522279 6:64698150-64698172 ATAAAACGTACCAAAACCTTTGG + Intronic
1011210054 6:84945606-84945628 TTAAAACCTTCCACAAAGTTTGG + Intergenic
1012068055 6:94575807-94575829 TTAAATCATTCCAAGAAGGTGGG + Intergenic
1012752931 6:103185505-103185527 ATCAAACATTCCAAAACTGTGGG + Intergenic
1014957890 6:127643466-127643488 ATAAAACTTTCCAAAACTTTAGG + Intergenic
1016051653 6:139536379-139536401 AGAAAACTTTCCAAAAAGCTTGG - Intergenic
1016432349 6:143999574-143999596 ATAAATCGCTCCAGAAAGTTGGG + Intronic
1019855265 7:3599567-3599589 ATAAAACATTTCAAAAAAATGGG - Intronic
1021187764 7:17585335-17585357 CTAAAACGTTCTAAAACGTTAGG - Intergenic
1022081045 7:27021449-27021471 ATAAAATATTCGAAAAAAGTCGG + Intergenic
1022937690 7:35196973-35196995 ATAAAAGATTTCTAAAAGGTTGG + Intergenic
1025775502 7:64557589-64557611 AAAAAACTTACCAAAAAGGCCGG + Intronic
1025780598 7:64598334-64598356 ATTAAATGTGCCAAAAAGATAGG - Intergenic
1028372439 7:90108619-90108641 ATAAAAGATTTCTAAAAGGTTGG - Intergenic
1032581911 7:133111500-133111522 AAAAAACAATCCCAAAAGGTAGG + Intergenic
1034187474 7:149190063-149190085 ATAAAATGTTGCCAAAAGGAGGG + Intergenic
1036074038 8:5474821-5474843 ATAAAGCATTTCAAAAAGGAGGG - Intergenic
1038829401 8:31040551-31040573 ATAAAATGTTTCAAGAAGATGGG + Intronic
1039164462 8:34662064-34662086 ATAAAACAGTCTAAAAAGCTTGG - Intergenic
1039815809 8:41093501-41093523 ATAAAAAGATAAAAAAAGGTAGG + Intergenic
1044333919 8:90953609-90953631 ATAAAACTTTAAAATAAGGTGGG - Intronic
1044364058 8:91322795-91322817 ATAAAAACTTCCAAGAAGGATGG - Intronic
1045150327 8:99399907-99399929 AGAAAACGATCCAACAAGATAGG - Intronic
1046150173 8:110213129-110213151 ATTTAAAGTGCCAAAAAGGTGGG + Intergenic
1046251548 8:111638566-111638588 ATAAAACCTGCCAAAAACGATGG + Intergenic
1046653870 8:116872503-116872525 ATCAAACAGTACAAAAAGGTAGG - Intronic
1050510647 9:6391202-6391224 ATAAAAACTTTCAAAAAGCTGGG + Intergenic
1051130246 9:13852430-13852452 ATAAAATATTCCATGAAGGTGGG + Intergenic
1051941463 9:22510459-22510481 ATAAAAAACCCCAAAAAGGTAGG + Intergenic
1058057922 9:100468002-100468024 ATAATACTTACCAAAAAGGTGGG + Intronic
1059027753 9:110654611-110654633 ATAGAATGTACTAAAAAGGTGGG + Intergenic
1059621426 9:116010067-116010089 AAAAAACTTTCCAAAAAAATGGG - Intergenic
1060118525 9:120966183-120966205 ACAAAATGTTCCAGAAAGGCGGG - Intronic
1060287369 9:122265588-122265610 ATAAAGCTTTCCAAAATGGGGGG - Intronic
1186380119 X:9049072-9049094 GTAAAAAGTTCCCAAAAGATGGG - Intronic
1187797157 X:23016318-23016340 ATAAAAGTTTCCAAAAAGAATGG - Intergenic
1188638706 X:32470385-32470407 ATAAAATGTTCAAAAAATGTGGG - Intronic
1191723841 X:64258373-64258395 ATAAAAAGATTCAAAAAGGAGGG - Intergenic
1192944246 X:75948658-75948680 ACAAAACCTTCCAAAATGATGGG - Intergenic
1193533999 X:82690783-82690805 ATAAAAATTACCAAAAAAGTTGG - Intergenic
1198392657 X:136191893-136191915 TTAAAATGTTCATAAAAGGTGGG + Intronic
1200914431 Y:8558967-8558989 ATAAAATGTTCCTTGAAGGTTGG - Intergenic
1201984419 Y:19949753-19949775 ATAAAATGTTCTGTAAAGGTTGG + Intergenic