ID: 1148783310

View in Genome Browser
Species Human (GRCh38)
Location 17:50133580-50133602
Sequence GAAAAGCAGTTTGCTGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148783299_1148783310 28 Left 1148783299 17:50133529-50133551 CCCAGGAGGACTGGACAAAAAGC 0: 1
1: 0
2: 3
3: 17
4: 178
Right 1148783310 17:50133580-50133602 GAAAAGCAGTTTGCTGGAACCGG 0: 1
1: 0
2: 2
3: 18
4: 189
1148783300_1148783310 27 Left 1148783300 17:50133530-50133552 CCAGGAGGACTGGACAAAAAGCA 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1148783310 17:50133580-50133602 GAAAAGCAGTTTGCTGGAACCGG 0: 1
1: 0
2: 2
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148783310 Original CRISPR GAAAAGCAGTTTGCTGGAAC CGG Intergenic
900739177 1:4320247-4320269 GTAAGGCAGTTTCCTGGTACGGG + Intergenic
903323725 1:22557273-22557295 GAACAGCAGTTTGCTGGAAGGGG + Intergenic
904074671 1:27831014-27831036 GAAAAACTGTTTGCTGCACCGGG + Intronic
906636739 1:47415486-47415508 GAAAAGCTGTTTTCTTTAACAGG + Intergenic
907125530 1:52047048-52047070 GAAAAGAATTTTGCTGTACCAGG + Intronic
908728559 1:67202523-67202545 GAAAAGCTGTTAGCTGGCAGTGG - Intronic
909378561 1:74969660-74969682 GAATACCAGTTTCCTGGAAGTGG + Intergenic
913009308 1:114667131-114667153 GAATAGGAGTTTGCTGAAATTGG - Intronic
915456083 1:156041742-156041764 GAAAAGCAGTTGGAAGAAACAGG + Intronic
916016217 1:160752042-160752064 GAAAAGGAGGGTTCTGGAACAGG - Intronic
917788574 1:178485391-178485413 GACAAGCAGTTTGATGCGACTGG - Intergenic
920035390 1:203061833-203061855 AACAAGCAGTTTGAGGGAACTGG - Intronic
920958142 1:210638492-210638514 GAATAGTAGTTGTCTGGAACTGG + Intronic
922932503 1:229401372-229401394 GAAAGGCAGCTTCCTGGAGCTGG - Intergenic
924084877 1:240440743-240440765 GATAACCAGTTTGCTTGAAAAGG + Intronic
924567104 1:245208035-245208057 GAAAAGAAATCTGCTGGAAAAGG - Intronic
1065679944 10:28219284-28219306 CAGAAGCAGTTTTCTGGAATTGG - Intronic
1067122742 10:43488468-43488490 TAAAAGCAGTTTGTTGCAACTGG + Intergenic
1067182046 10:43995548-43995570 GAAATGCAGTGTGCTGCAATGGG + Intergenic
1069047216 10:63755719-63755741 GAACAGCAGATTGCTGGGAATGG - Intergenic
1069079014 10:64068200-64068222 GAACTGCAGTTTCCTGGAAGAGG + Intergenic
1069890556 10:71649593-71649615 GAAACTCATTTTGCTGTAACTGG - Intronic
1069938614 10:71937598-71937620 GAGAAGCAGTTTTCTGTCACTGG - Intergenic
1070497180 10:77035140-77035162 GGAAAGCAATTTGCTGTAACTGG + Intronic
1072808890 10:98444824-98444846 GAAAAGGAGGTTGCTGGGAGAGG + Intronic
1073088867 10:100915391-100915413 GAAGAGGAGTTTGCTGGACAAGG - Intronic
1075921154 10:126214812-126214834 GAATAGCAGCTTTCTGGAATGGG + Intronic
1078610897 11:12818571-12818593 GAAAAGCAGTTTGGAGGAGCTGG - Intronic
1080537550 11:33236682-33236704 CAAAAGCAGTTAACTGGACCAGG - Intergenic
1083948211 11:65938011-65938033 CAAATCCAGTTTGCTGGTACAGG - Intergenic
1086323912 11:85679107-85679129 GAAAGGCAGTTTTCTTGATCAGG + Intronic
1086583639 11:88427360-88427382 AAAAACCAGTTAGCTGGACCTGG + Intergenic
1090316756 11:125797799-125797821 GAAAAGTAGTTTCCTGGGGCGGG - Intergenic
1091313160 11:134589194-134589216 GGCAAGCAGTTTCCTGGAAAGGG - Intergenic
1092968190 12:13665937-13665959 GAAAGGAAGTTTGCTGGCAAAGG - Intronic
1093187410 12:16036755-16036777 GTAAAGAACTTTTCTGGAACTGG - Exonic
1093254803 12:16853885-16853907 GAAAAGCAATGGGCTGGAATGGG + Intergenic
1093721531 12:22447914-22447936 GAAAAGTAGTTCACTGGAATTGG - Intergenic
1099063121 12:77937546-77937568 GAAATACAGTTTGATGGAAGTGG + Intronic
1104333995 12:127875590-127875612 GAACAGCAGGTTGCAGGAAACGG - Intergenic
1107155679 13:37164796-37164818 CAAAGGCAGTTTGAGGGAACAGG + Intergenic
1107564122 13:41584405-41584427 GATGAGGAGTTTGCAGGAACAGG + Intronic
1110979363 13:81875609-81875631 CAAAGGCAGTTTGCAGGAAGGGG - Intergenic
1111725468 13:92002845-92002867 GAACAGCAGAGTGCTGGCACAGG - Intronic
1113237233 13:108292151-108292173 ATAAAGCAGATTGCTGGTACAGG - Intronic
1114372695 14:22108001-22108023 GAAAAGAAGTTTGGTGAAACAGG + Intergenic
1114457512 14:22865719-22865741 GAAGTGCAGTTTGCAGGAAGAGG + Intergenic
1114844421 14:26303886-26303908 AAAAAGCAGTGTGCTGAATCTGG + Intergenic
1116856271 14:49955133-49955155 GAAAAGAAATTTGCTGGGGCAGG - Intergenic
1121580918 14:95029381-95029403 GAAAATCAGTTGGCTGTAAGTGG - Intergenic
1122404026 14:101488326-101488348 CATAAGCAGTTTTCTGAAACCGG - Intergenic
1124567327 15:30827994-30828016 CAAAAGAAGTTTGTTGGAAAAGG - Intergenic
1126371343 15:47950333-47950355 GAAAAGCAAATTACTGTAACTGG + Intergenic
1131105927 15:89734614-89734636 GAAAAGCAGTTGGCTGTATTTGG - Intronic
1131217248 15:90548396-90548418 GAAAACCACCTTGCTGGACCTGG - Intronic
1131368573 15:91860900-91860922 GGAAACCAGGTTGCAGGAACAGG - Intronic
1131580833 15:93641383-93641405 GAACAGCAGTTTCCAGGAAATGG + Intergenic
1132234663 15:100210255-100210277 AAAAAGAAGTGAGCTGGAACAGG + Intronic
1133260194 16:4544245-4544267 GAAATGTAGTGAGCTGGAACTGG + Intergenic
1136050071 16:27643954-27643976 AAAAAGCAATTTCCTAGAACTGG - Intronic
1141149332 16:81553215-81553237 GAAAAGCAGTGGGCGGGAATGGG - Intronic
1142383852 16:89749908-89749930 AAAGAGCAGTATGCTGGCACAGG + Intronic
1144198157 17:12915729-12915751 GAAATGCAGAGAGCTGGAACAGG + Intronic
1145081202 17:19895818-19895840 GAAAATAAGTTTGCTGTAAATGG - Intergenic
1147534196 17:41308093-41308115 GCAAGGCCGTTTGCTGGAACTGG + Exonic
1148783310 17:50133580-50133602 GAAAAGCAGTTTGCTGGAACCGG + Intergenic
1149374735 17:56032650-56032672 CAAGAGTAGTTTGCTGGAAAGGG + Intergenic
1151398898 17:73842930-73842952 GAAAATCAGTTGGCTGGGAGGGG - Intergenic
1153055756 18:944842-944864 GAAAAGGATTTTTCTGGAGCTGG + Intergenic
1153956294 18:10099131-10099153 GAAAACCAGTTTGCCAGAACTGG - Intergenic
1155059475 18:22216155-22216177 GCAAAGCAGTTTAAAGGAACTGG - Intergenic
1155700260 18:28734465-28734487 CAAAAGCAGTTTGAAGGAAGGGG - Intergenic
1159501997 18:69284019-69284041 GCAAAGCAGTTTGGGGGAAGTGG - Intergenic
1160181192 18:76638186-76638208 GGTAAGGAGTTTGCTGAAACAGG - Intergenic
1160313985 18:77823014-77823036 GAAAGGCAGTGCGATGGAACGGG - Intergenic
1165940138 19:39410719-39410741 GGGAAGCAGTTTCCTGGAAGAGG - Intergenic
1166323228 19:42032689-42032711 GAGGAGCAGTTTGCTGGGGCCGG - Intronic
1166444808 19:42849321-42849343 GAATAGTAGTTTGCAGGAGCTGG + Intronic
1166447782 19:42873061-42873083 GAATAGTAGTTTGCAGGAGCTGG + Intronic
1166481769 19:43180177-43180199 GAATAGTAGTTTGCAGGAGCTGG + Intronic
1166487480 19:43225701-43225723 GAAAAGCTGTTTGCTGACATGGG - Intronic
1166491360 19:43263165-43263187 GAATAGTAGTTTGCAGGAGCTGG + Intronic
1166765397 19:45250130-45250152 AAACAGCAGTGTGCTGGATCTGG - Intronic
1168512051 19:56980759-56980781 GAACAGCACCTTGCTGGAAGGGG - Intergenic
927596784 2:24403704-24403726 TAAAAGCAGGCTGCTGGAACCGG + Intergenic
928886040 2:36149500-36149522 GAGTAGCAGTGTGCTGGAGCCGG - Intergenic
932138053 2:69247890-69247912 GCAAAGCATTTTGATGGAATAGG + Exonic
933279709 2:80319657-80319679 GAAAAGCAGAATTGTGGAACTGG - Intronic
935744642 2:106179664-106179686 GAACAACAGTTTGAAGGAACAGG + Intronic
935797088 2:106653468-106653490 GAACATCAGGTTGCTGGACCCGG + Intergenic
939559688 2:143717821-143717843 GAAATGCAGTTTCCTGGAGCGGG - Intronic
939616463 2:144366954-144366976 GAAAGGCAGTTTGCTCTACCTGG - Intergenic
940077200 2:149755588-149755610 GAAAATCGCTTTGCTTGAACTGG - Intergenic
941035752 2:160567606-160567628 GAAATGCAGTTTGCAGTAAATGG - Intergenic
948706573 2:239796962-239796984 GAAAATAAGTTTGCTGAAAGAGG - Intronic
1169535523 20:6534717-6534739 GGAGAGCAGTTTCATGGAACTGG + Intergenic
1171302567 20:24076457-24076479 AACAAGCAGTGTGCAGGAACAGG + Intergenic
1172436890 20:34935259-34935281 GGTCAGCAGTATGCTGGAACTGG + Intronic
1173681734 20:44886499-44886521 GAAAATCTGTTTGTTGGAGCCGG + Intronic
1173985573 20:47259115-47259137 GAATAGCTCTTTGCTGAAACTGG - Intronic
1174385630 20:50187154-50187176 GAAAAGCAGTTTGGGGGCAGAGG + Intergenic
1176936957 21:14878500-14878522 AAAAAGGAGTTTGCTGAAAATGG + Intergenic
1178413771 21:32387278-32387300 GAAAGGCAGTTTTATAGAACAGG - Intronic
1181353922 22:22283673-22283695 GAAAAAGATTTTACTGGAACAGG + Intergenic
1181686668 22:24533945-24533967 GAAAAGGAGGTGGCTGGTACTGG - Intergenic
949256798 3:2057902-2057924 GAAAAGAAGTGTACTGTAACAGG - Intergenic
949299231 3:2564171-2564193 GAAAAGCAGTTTGTTGCCCCTGG + Intronic
950632411 3:14291569-14291591 GAACAGCCGGTTGGTGGAACAGG - Intergenic
951161981 3:19434560-19434582 GGCAAGCAGTTTGCTGGGAGAGG - Intronic
951908489 3:27726091-27726113 GAGAAGCATTTGGTTGGAACAGG + Intergenic
953026987 3:39151192-39151214 GAAAAGCAGTTCCCAGGAGCTGG + Intronic
953986462 3:47447106-47447128 AAAAAGCAGTTGTCTGGACCAGG + Intronic
953994782 3:47511588-47511610 GAAAATCAGATTGCTAGGACTGG + Intronic
954439704 3:50515136-50515158 GAAATGCAGTGTCCTGGAATGGG - Intergenic
955956049 3:64291398-64291420 GAGAAGCAGTCTTCTGGAGCAGG + Intronic
956068077 3:65418154-65418176 GGACAACAGTCTGCTGGAACTGG - Intronic
956176191 3:66475405-66475427 TGAGAGCAGTTTGCTGGAAAAGG + Intronic
956572276 3:70710177-70710199 GAAAGGATGTTTGCTTGAACAGG - Intergenic
958478417 3:94615409-94615431 GAAAATCAGCTTGTTGCAACAGG - Intergenic
959966556 3:112362127-112362149 GCAAAGCAGTAAGCAGGAACTGG - Exonic
963533380 3:146498077-146498099 TAAAAGCAGGCTGCCGGAACTGG + Intergenic
964785322 3:160390120-160390142 GAAAAGCAGTTTCCAGGGACAGG + Intronic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
966226247 3:177601383-177601405 GAAAAGCAGCTTGCTGACAGGGG - Intergenic
967135644 3:186510562-186510584 GAAATGCAATTTGCTGGTGCTGG - Intergenic
967419832 3:189260710-189260732 AGAAAGCAGTTTCCTGGACCTGG - Intronic
968788718 4:2644165-2644187 GAAAAGCAATCTGCAGGCACAGG - Intronic
973257004 4:48123786-48123808 GAAGAGCAGTTGGCTGAAGCAGG - Intronic
973537050 4:51893985-51894007 GAGAAGCAATTTCCTGGAAGAGG + Intronic
973997450 4:56473471-56473493 GAAAATCAGTTTTCTGGGTCGGG + Intronic
976621770 4:87135623-87135645 CAACAGCAGTTTGGTGGACCTGG + Exonic
977271943 4:94927741-94927763 GAAAAGCAGTAACTTGGAACTGG + Intronic
978204622 4:106066291-106066313 GAAAATCAGTGTGCTGCAGCTGG - Intronic
978289519 4:107120609-107120631 GAAAAGCAGAATTTTGGAACTGG - Intronic
979277384 4:118828937-118828959 GGGAAGCAGTTTGCTGGGATTGG - Intronic
979943257 4:126790660-126790682 GAAAAGCATTTTACTTGACCTGG - Intergenic
979957602 4:126973766-126973788 GTAAAGCAGTTTTCTTGGACTGG + Intergenic
980025688 4:127763520-127763542 GAAAAGCATCTTGCTGAACCTGG + Intronic
980122076 4:128737956-128737978 GAACAGAAGTTTGCTAGAATTGG + Intergenic
981238061 4:142441683-142441705 GAAAAGAAGTTAGTTGGAAAAGG + Intronic
981595423 4:146415972-146415994 GGAAAGCAGTTTGTTGGAATTGG - Intronic
981688389 4:147480613-147480635 GGACAGCAGTTTACTGGATCAGG - Intergenic
981778862 4:148401891-148401913 GAAAAGCTGGTTGCTGGCATGGG - Intronic
983730980 4:170992892-170992914 GACAAGCAGTTTGACGGAAGAGG - Intergenic
985910843 5:2880149-2880171 GAAAAACAGATTACTGTAACTGG + Intergenic
989577718 5:43004171-43004193 GAATAGTAGTTTGCAAGAACTGG + Intergenic
990864508 5:60366188-60366210 GAAAGGCAGTAGGCAGGAACAGG - Intronic
993129560 5:83878356-83878378 GAAAAGCACTTTGCTAAGACAGG + Intergenic
995111071 5:108429010-108429032 AAAAAGCAGTTTGCTGGAGGAGG + Intergenic
995906697 5:117132811-117132833 GAAAACCAACTTGCAGGAACTGG - Intergenic
999196475 5:149784860-149784882 GAAACTCAGTTGGCTGGACCGGG - Intronic
1000784608 5:165528383-165528405 GAAAAATAGTTTCCTGGAATGGG + Intergenic
1000965337 5:167648972-167648994 GAAAAGAAGTCTGCTGCATCAGG - Intronic
1002025746 5:176395212-176395234 GAGAAGGAGTTTGCTGGATAGGG - Intronic
1002408966 5:179059098-179059120 GAAAATCAGTTGGCTGTAAATGG + Intergenic
1005821011 6:29599158-29599180 TAAAAGCAGTCTGCTGCATCTGG - Intronic
1005935902 6:30520805-30520827 TAAAAGCATCTTGCTGGAATAGG + Intergenic
1011239835 6:85259139-85259161 GCAAAGCATTTTTCTGGAAAAGG + Intergenic
1011281257 6:85679993-85680015 GAAAAGCACTTTTCTCTAACAGG + Intergenic
1012018807 6:93889724-93889746 TAAAAGCAGTTTCAGGGAACTGG - Intergenic
1012602439 6:101114761-101114783 GAAAAGCAGTTTGCCAGTATTGG + Intergenic
1014681670 6:124438674-124438696 CAAGAGCTGTTTGCTGGAAAGGG - Intronic
1015881091 6:137870500-137870522 GCAAAGCATCTTGCTGGAAATGG + Intronic
1016314108 6:142767893-142767915 GAAAAGGATATTGATGGAACTGG + Intronic
1016733297 6:147449142-147449164 CAAAGGCAGTTTGGGGGAACGGG - Intergenic
1018717546 6:166545242-166545264 GGAAAGCAATGTGCAGGAACAGG + Intronic
1018979194 6:168589526-168589548 GAAAAGCTGGAAGCTGGAACTGG + Intronic
1019364069 7:622355-622377 GAAATGCAGATTGTTGGAGCGGG - Intronic
1020732666 7:11903232-11903254 GAAAATCAGTTTCCTGTAAATGG - Intergenic
1021487762 7:21185780-21185802 GAAAACCCGTCTGCTGGAAAGGG + Intergenic
1024604060 7:51010591-51010613 GAAAAGGAGTTTCCTGGCACAGG - Intergenic
1026480932 7:70779026-70779048 TACAAGCAGTTTGCTGAAAAGGG - Intronic
1027704022 7:81506792-81506814 GAACAGTAGTATGCTGGAGCTGG - Intergenic
1028437190 7:90817631-90817653 GAACAGCAGATTGGTGGAGCTGG + Intronic
1028505731 7:91568289-91568311 AAAAGACAGTTTGCTGGAAGGGG - Intergenic
1028933037 7:96435247-96435269 GAAAATCAGTTGGCTGTAAATGG + Intergenic
1029944206 7:104514572-104514594 AAAAAGCAGTTGGCTGGGAATGG + Intronic
1030838028 7:114312492-114312514 GAGACACGGTTTGCTGGAACAGG - Intronic
1031658756 7:124393876-124393898 GTGCAGCAGTGTGCTGGAACTGG - Intergenic
1031960161 7:127981920-127981942 GAAAAGCAGGTTGTTGTAACAGG + Intronic
1033127135 7:138716265-138716287 GAAAACAATTTGGCTGGAACTGG + Intronic
1036064637 8:5366034-5366056 GTAAGGCAGTTTGCAGGAAGTGG + Intergenic
1038081517 8:24142450-24142472 GAAATGCAATTTGGTAGAACAGG + Intergenic
1039042860 8:33424617-33424639 GAAAGGGAGTTAGCTGGAAAGGG - Intronic
1039943936 8:42114316-42114338 GAAAAGCAGGTTCCTGGAAGAGG - Intergenic
1040008293 8:42639581-42639603 GAAAAGCAGATTGCTTGGATGGG + Intergenic
1040985100 8:53285324-53285346 GAAAAACAGTTTGCAGGCATTGG - Intergenic
1042338604 8:67655431-67655453 GAAAAGGATTTTGATGGAAAGGG + Intronic
1043686317 8:83090982-83091004 GAAGAGAAGTTTGCTGGCATGGG - Intergenic
1046222042 8:111228988-111229010 GATGAGCAGTTTGCAGGAAGTGG + Intergenic
1050725227 9:8641948-8641970 CAAAAGCAGTTTGCTGGTCTTGG - Intronic
1051107562 9:13597149-13597171 GGAAAGTACTTTGCTGCAACAGG - Intergenic
1053294535 9:36903237-36903259 GAAAAGCAGTTGGCTGGGAAGGG + Intronic
1055009330 9:71546744-71546766 AAAAAGCAGTTAGCTGGACATGG + Intergenic
1056390442 9:86136502-86136524 GAAAAGCAGTTTGATCGACTGGG + Intergenic
1058448581 9:105075521-105075543 CAAAAGAAGTTTGCTGAAGCCGG + Intergenic
1060100783 9:120839396-120839418 GAAAAGGAATTTGCTAGAAAAGG + Intronic
1060509390 9:124221157-124221179 GAAAAGCAGTTTGCAGGAGAGGG - Intergenic
1061516156 9:131091640-131091662 GAAACTCAGTCTGCTGGAGCAGG + Exonic
1062466983 9:136685887-136685909 GGAAGGCAGTTTGCAGAAACAGG - Intronic
1189049144 X:37625723-37625745 GAAAAGTAGCTTGCTCAAACAGG - Intronic
1189921603 X:45908277-45908299 GAAATGCAGCTTGTTAGAACTGG - Intergenic
1190517911 X:51243745-51243767 GAAGAGCAGGTTGCTGCTACTGG - Intergenic
1192287805 X:69756789-69756811 GAAAAAAAGTTTGCTGGTATAGG - Intronic
1194983723 X:100467498-100467520 TAAAAGCAGTTTGAGAGAACGGG - Intergenic
1194997465 X:100606933-100606955 GAGAAGTAGTTTGGAGGAACAGG - Intergenic
1198331155 X:135624162-135624184 GAAAAGCATTATGCTGGAACAGG - Intergenic
1198335185 X:135658962-135658984 GAAAAGCATTATGCTGAAACAGG + Intergenic
1198363688 X:135920352-135920374 GAAAAGCATCGTGCTGGAACAGG - Intergenic
1198486986 X:137097274-137097296 AAAAAGCAGTTTGGTGGAGATGG + Intergenic