ID: 1148783466

View in Genome Browser
Species Human (GRCh38)
Location 17:50134195-50134217
Sequence TCCCCACTTTAACCCCAAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148783466_1148783471 27 Left 1148783466 17:50134195-50134217 CCAATTTGGGGTTAAAGTGGGGA 0: 1
1: 0
2: 0
3: 16
4: 85
Right 1148783471 17:50134245-50134267 GGCTGCCAGCAGGGCAGCCCTGG 0: 1
1: 1
2: 6
3: 63
4: 615
1148783466_1148783467 2 Left 1148783466 17:50134195-50134217 CCAATTTGGGGTTAAAGTGGGGA 0: 1
1: 0
2: 0
3: 16
4: 85
Right 1148783467 17:50134220-50134242 CAGAGTCGATTTCACTTAGAAGG 0: 1
1: 0
2: 2
3: 5
4: 76
1148783466_1148783468 6 Left 1148783466 17:50134195-50134217 CCAATTTGGGGTTAAAGTGGGGA 0: 1
1: 0
2: 0
3: 16
4: 85
Right 1148783468 17:50134224-50134246 GTCGATTTCACTTAGAAGGCAGG 0: 1
1: 0
2: 2
3: 2
4: 53
1148783466_1148783469 17 Left 1148783466 17:50134195-50134217 CCAATTTGGGGTTAAAGTGGGGA 0: 1
1: 0
2: 0
3: 16
4: 85
Right 1148783469 17:50134235-50134257 TTAGAAGGCAGGCTGCCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1148783466_1148783470 18 Left 1148783466 17:50134195-50134217 CCAATTTGGGGTTAAAGTGGGGA 0: 1
1: 0
2: 0
3: 16
4: 85
Right 1148783470 17:50134236-50134258 TAGAAGGCAGGCTGCCAGCAGGG 0: 1
1: 0
2: 1
3: 44
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148783466 Original CRISPR TCCCCACTTTAACCCCAAAT TGG (reversed) Exonic
900457592 1:2785093-2785115 TCCCCACTTCCACCCGACATGGG + Intronic
906691973 1:47798693-47798715 TCCCCTCTTTACCCCCATCTAGG + Intronic
906857192 1:49320660-49320682 TCACCACTATCACCCCAAACAGG + Intronic
908420359 1:63952961-63952983 TCCCCTTAGTAACCCCAAATAGG - Intronic
908797240 1:67843051-67843073 TCCTCCCCTTAACCCCAAGTGGG - Intergenic
908926546 1:69262097-69262119 TCTCCACTTGAATGCCAAATAGG - Intergenic
911391623 1:97251960-97251982 TCTGCACTTTATGCCCAAATTGG + Intronic
914854928 1:151343872-151343894 TCCCCACTTCAGCCAGAAATGGG - Exonic
923203030 1:231731033-231731055 TTCCCTGTATAACCCCAAATGGG + Intronic
923544056 1:234911390-234911412 ACCCCACTCTACCCCCAAACAGG - Intergenic
924806860 1:247368244-247368266 TCCCCACTTTCAGACCATATAGG - Intergenic
1069568460 10:69479488-69479510 TTCCCTCTTTGGCCCCAAATGGG + Intronic
1074348724 10:112714042-112714064 TCCCCACTGTAACCCCATCCAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1081558858 11:44193828-44193850 TGCCCACTTGCATCCCAAATAGG - Intronic
1085909554 11:80805377-80805399 CCTCAACTTAAACCCCAAATAGG + Intergenic
1087715466 11:101603419-101603441 TCCCCACATTATCCTCACATAGG - Intronic
1090005251 11:122996725-122996747 TCCCCACTTTAACCCAGTAATGG + Intergenic
1090265092 11:125348625-125348647 TCCCCTCCTTAACCCCACACAGG + Intronic
1098451321 12:70621276-70621298 TCCCTGCTTTAAGCCCAAACTGG + Intronic
1099833630 12:87878285-87878307 TCCCCACTCTAACCCAGAAGAGG + Intergenic
1099984500 12:89647500-89647522 CCCCCACTTTATTCCTAAATTGG - Intronic
1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG + Intergenic
1108527355 13:51297106-51297128 TCCCCCCTTTAATCCAAAGTGGG - Intergenic
1113262317 13:108578378-108578400 TTCCTATTTTAAACCCAAATGGG + Intergenic
1113371405 13:109728622-109728644 TACCTACTTTAAGCCCAATTAGG - Intergenic
1115041185 14:28930668-28930690 TGCCCTCTTTAACCCCAGATCGG + Intergenic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1119212618 14:72843948-72843970 TCCCCACTTTACACCCAGAGAGG + Intronic
1121126493 14:91410354-91410376 TCCCCACACTAACCCCCAAGAGG - Intronic
1132083780 15:98889890-98889912 TTCCTACTTTATCCTCAAATTGG - Intronic
1132420415 15:101661194-101661216 TCCCCACTGTCATCCTAAATGGG + Intronic
1137917642 16:52450382-52450404 TCCCAAATTCAACCCCAACTGGG + Exonic
1142904893 17:3034794-3034816 TGCCCACCTTAACCCCAACCCGG - Exonic
1144035749 17:11364067-11364089 TCCCCAGCTAAACCCCAATTTGG + Intronic
1148499712 17:48080511-48080533 TAACCAGTTTAACCTCAAATTGG - Intronic
1148783466 17:50134195-50134217 TCCCCACTTTAACCCCAAATTGG - Exonic
1160887484 19:1357370-1357392 TCCCTATTTTAACCACAAATAGG - Intronic
1163184014 19:15623775-15623797 TCCCCACTGTAGCCCCAGACTGG - Intronic
1163187897 19:15652645-15652667 TCCCCACTCTAGCCCCACACTGG - Intronic
1163835480 19:19570958-19570980 ACTCCACTTTATCACCAAATTGG + Intronic
1164405208 19:27938090-27938112 TTCCCAGTTTAACACAAAATGGG + Intergenic
1167830592 19:52018229-52018251 TCCCCTCTCTGACCCCAAAGTGG - Intronic
925550729 2:5071351-5071373 TCCTCACTGTATCCCCAACTGGG - Intergenic
926384589 2:12323691-12323713 TCCCCAGTGTAACCCCAATTTGG + Intergenic
929251854 2:39766455-39766477 CCCTCATTTTAACCTCAAATAGG + Intronic
929392686 2:41489345-41489367 ACCAGACTTTAACCCCAAATTGG - Intergenic
929500379 2:42486093-42486115 TCCCCACAATATCCCCAAATGGG + Intronic
935755420 2:106272857-106272879 TCCCAACTTTGACTACAAATGGG - Intergenic
939191176 2:138918018-138918040 TTCCCACTTTGACCCCAATTTGG - Intergenic
941141436 2:161788446-161788468 TCCCCACACTAACCTCAATTAGG - Intronic
943429605 2:187782783-187782805 TCCTCAGTTTAATCTCAAATGGG + Intergenic
945968049 2:216209332-216209354 CCCACACTTTTACCCCATATAGG + Intergenic
1168972129 20:1938023-1938045 TCCCCACTCTAGCCCCAGTTGGG - Exonic
1170145581 20:13170417-13170439 TCCCTACATTAAACCCAGATTGG - Intergenic
1176648734 21:9527148-9527170 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1179214155 21:39351492-39351514 TCCCCACCTCAACCCCAACCAGG - Intergenic
1179632640 21:42688307-42688329 TCCCCACATTAACCCCAGGAAGG + Intronic
1181382400 22:22516835-22516857 TCCCCAGATTAACCCCATCTGGG + Intronic
1182755108 22:32673008-32673030 TTCCCACTTGAACCCCATCTGGG - Intronic
1184974426 22:48051052-48051074 TCTGCACTTGGACCCCAAATTGG + Intergenic
949555372 3:5148000-5148022 TCCAAACGTTGACCCCAAATGGG - Intronic
950435399 3:12976318-12976340 TCCCCACTGTGACCCCACCTGGG - Intronic
952005280 3:28836189-28836211 TCCCCATTCTAACCCCATCTCGG - Intergenic
959133681 3:102390277-102390299 TCCCAACTTTTACCCCCAACCGG + Intronic
964498575 3:157322973-157322995 TCTGCACTTTTTCCCCAAATTGG - Intronic
964760751 3:160133309-160133331 TCCCCCCTGTAACCCCAACAGGG + Intergenic
965191860 3:165540799-165540821 TCCCCACATTAACCCTCAATTGG + Intergenic
966534881 3:181020812-181020834 TCCCCACTTTAACCTTAAAGAGG - Intergenic
973068501 4:45827245-45827267 TCCCCACTTTAACCAGCAATTGG + Intergenic
984122975 4:175769407-175769429 TCCCAACTTCAAACCCAGATAGG - Intronic
986250963 5:6058387-6058409 TCCTGACTTTAACCCCCAACAGG + Intergenic
987297966 5:16570795-16570817 TCCCCAATTTCAGCCCAAACAGG - Intronic
988508361 5:31843774-31843796 ACCTCACTTTAACCCCAAGGAGG - Intronic
989527530 5:42469968-42469990 TCCCCACTCTTACCCCATTTAGG - Intronic
991534882 5:67658452-67658474 TCCTCACTTTAAATCCAACTTGG - Intergenic
992215535 5:74521359-74521381 TCCCCACTTTAACCCTATAGTGG + Intergenic
996969732 5:129350772-129350794 TGCAAACTTTAACCCCAACTGGG - Intergenic
999240973 5:150127172-150127194 TCACCACTCCAACCCCAACTGGG - Intronic
999768680 5:154758037-154758059 TCCCCTCTTTAAACTCAAAAGGG + Intronic
1001494641 5:172179273-172179295 GCCCTATTTGAACCCCAAATAGG - Intronic
1003369582 6:5511096-5511118 CCCACACTTTCACCCCAGATTGG + Intronic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1011629860 6:89312856-89312878 TTCCCACTTTAACACCTCATGGG + Intronic
1011728321 6:90233591-90233613 TCCTCACATAAACCCCAAAAGGG - Intronic
1014486005 6:121999966-121999988 TGCCCACTAAAACCACAAATGGG - Intergenic
1015622438 6:135145595-135145617 TTCCCACTTTCACCCAAAAAGGG - Intergenic
1023331517 7:39122661-39122683 TCCCCAGTTTAACTCTAAATTGG - Intronic
1024043435 7:45572588-45572610 TCCCCTGCTTATCCCCAAATAGG - Intergenic
1025275206 7:57576895-57576917 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1035268802 7:157707714-157707736 TCCCAACTGTAATCCCAATTGGG - Intronic
1036648244 8:10625476-10625498 TCCCCACTTGACCCCCAGCTGGG - Intronic
1057437766 9:95058219-95058241 TCCTCAACTTAACCCCAACTAGG - Intronic
1058567026 9:106296913-106296935 TCTTCACTTTAACCTCAACTAGG - Intergenic
1203626470 Un_KI270750v1:30698-30720 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1188245374 X:27831155-27831177 TTCTCACTTTAACCCCTAACAGG - Intergenic
1188441149 X:30216088-30216110 TCCTCACCTTAACCCCAGTTAGG - Intronic
1193323202 X:80148755-80148777 TCATCACTTTAACCCCTAATTGG - Intergenic
1193842647 X:86426732-86426754 TCCTCAGTCTAACCCCAAAGAGG + Intronic
1196294250 X:113980444-113980466 TCTTCAGTTAAACCCCAAATAGG - Intergenic
1198025258 X:132699246-132699268 ATCCCACTTTGACTCCAAATAGG + Intronic
1200888161 Y:8293002-8293024 TCACCATTTTAGCCCCACATTGG + Intergenic