ID: 1148783915

View in Genome Browser
Species Human (GRCh38)
Location 17:50135945-50135967
Sequence GTACGTGGCTGGGGGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 511}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148783915_1148783924 1 Left 1148783915 17:50135945-50135967 CCGCCCAGCCCCCAGCCACGTAC 0: 1
1: 0
2: 4
3: 44
4: 511
Right 1148783924 17:50135969-50135991 TCTGCTGGTAGTCCTTGATGAGG 0: 1
1: 0
2: 3
3: 11
4: 116
1148783915_1148783925 8 Left 1148783915 17:50135945-50135967 CCGCCCAGCCCCCAGCCACGTAC 0: 1
1: 0
2: 4
3: 44
4: 511
Right 1148783925 17:50135976-50135998 GTAGTCCTTGATGAGGCGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148783915 Original CRISPR GTACGTGGCTGGGGGCTGGG CGG (reversed) Intronic
900104164 1:975283-975305 CTGCCTGGCTGGGTGCTGGGTGG - Exonic
900244110 1:1629846-1629868 GCTGGGGGCTGGGGGCTGGGGGG - Intronic
900245675 1:1635001-1635023 AGATGTGGGTGGGGGCTGGGAGG + Intronic
900256905 1:1702158-1702180 AGATGTGGGTGGGGGCTGGGAGG + Intronic
900285797 1:1899760-1899782 AAATGGGGCTGGGGGCTGGGTGG - Intergenic
900397056 1:2457346-2457368 GTGAGTGGCCAGGGGCTGGGGGG + Intronic
901012561 1:6209837-6209859 GCAGGTGGCTGGGGTCCGGGGGG + Intronic
901065127 1:6490716-6490738 GGAGGTGGCTGGAGGCCGGGCGG + Intronic
901526050 1:9823998-9824020 GTACCCGGCCGGGGGCGGGGTGG + Exonic
902606801 1:17573555-17573577 TAATGTGTCTGGGGGCTGGGAGG + Intronic
902686703 1:18081991-18082013 GCATGTGGCTGGTGGCTGGAGGG - Intergenic
903349989 1:22711413-22711435 GGCCGTGGCGGGGGGCGGGGGGG + Intronic
903659879 1:24970496-24970518 GTAGGTGGCTGTGGGGTGAGAGG - Intergenic
903925284 1:26827164-26827186 GTGCGCGGCAGGGGGCTGGGAGG - Intronic
903994744 1:27298758-27298780 GGCCCTGGCTGGGGGATGGGGGG - Intronic
904256804 1:29259580-29259602 GATCTTGGCTGGGGGCGGGGTGG + Intronic
904311600 1:29632820-29632842 CTGAGGGGCTGGGGGCTGGGAGG - Intergenic
904575244 1:31501299-31501321 GTGGGGAGCTGGGGGCTGGGAGG + Intergenic
904614590 1:31743013-31743035 GCACGTGGCCGGTGGCTGGGCGG + Intronic
904616586 1:31753421-31753443 GCACTGGGCTGGGGGCTGGTGGG - Intronic
904940962 1:34164723-34164745 GGACGTGGCTGAGGGTGGGGTGG + Intronic
905065875 1:35182158-35182180 GTGTGTGGGTGGGGGCTGGTCGG - Intronic
905335246 1:37240490-37240512 CTGCTTGGGTGGGGGCTGGGAGG - Intergenic
905910150 1:41647947-41647969 GGACTGGGCTGGGGGCTGGCAGG - Intronic
905915823 1:41683615-41683637 GGCCATGGCTGGAGGCTGGGAGG + Intronic
906573969 1:46870924-46870946 GTTGGGGGATGGGGGCTGGGAGG + Intergenic
906597999 1:47096957-47096979 GTTGGAGGGTGGGGGCTGGGAGG - Intronic
909443559 1:75724305-75724327 GGGCGTGGCTGGGGCCTGGAGGG - Intergenic
912839772 1:113029058-113029080 GTAAGGGGCTGGGGGCTGAAAGG - Intergenic
913049682 1:115106252-115106274 GCAGGTGGCTGGGGGCAGGTGGG + Intergenic
913521263 1:119647822-119647844 GTATGTGGCGAGGGGCGGGGAGG - Intergenic
913592379 1:120341631-120341653 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
913650979 1:120913514-120913536 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914170135 1:145215553-145215575 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914525252 1:148459516-148459538 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914598424 1:149176314-149176336 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914641150 1:149607618-149607640 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
915912481 1:159923465-159923487 GGACATGGGTGGGGGCAGGGAGG + Exonic
916059266 1:161087634-161087656 GACCGGGCCTGGGGGCTGGGAGG + Intronic
917954767 1:180083820-180083842 GTATGTGGCGGGCGGCGGGGAGG + Intronic
918148597 1:181779545-181779567 GATCATGGCTGGGGACTGGGAGG - Intronic
918205885 1:182308907-182308929 CTAGGTGCCTGGAGGCTGGGAGG - Intergenic
918358082 1:183724716-183724738 GGACCTGCCTGGGGCCTGGGGGG + Intronic
919844345 1:201631818-201631840 GTAGATGGCTGGGGGTTTGGGGG + Intronic
919857474 1:201715551-201715573 GAATGAGGCTGGGGGCAGGGAGG + Intronic
920066715 1:203274283-203274305 GTAGGTGGCTGGGGGTGGGGTGG + Intergenic
920074619 1:203327300-203327322 GTGGGTGGCTGGGGGGTGAGCGG - Intergenic
920116726 1:203626893-203626915 GTCCAAAGCTGGGGGCTGGGAGG + Exonic
920679831 1:208064008-208064030 GTAATTGGCTTGGGGGTGGGAGG - Intronic
920922633 1:210311127-210311149 GCACGTGGCGGGGGGGGGGGGGG - Intergenic
921974842 1:221191282-221191304 GTATGGGGGTGGGGGGTGGGGGG - Intergenic
922526195 1:226306035-226306057 GAAAGTGGCTGGGGGCGCGGTGG + Intronic
923014133 1:230112784-230112806 GTGTGTGGCAGGGGGGTGGGGGG + Intronic
923042091 1:230326822-230326844 GGACGGAGCTGGGGGATGGGAGG - Intronic
923506506 1:234609905-234609927 GTGCGGGGCGGGGGGCGGGGAGG + Intergenic
924085792 1:240450550-240450572 GAACGTGGCTGGGGCCGGGTGGG - Intronic
924299390 1:242621894-242621916 ATAAGTGGCTGGGAGGTGGGTGG - Intergenic
1063352279 10:5366621-5366643 GTGAGTGGCTGGGGGCTGGAAGG - Intronic
1065099842 10:22321722-22321744 GGACGGGGCTGGGGGCCGGCGGG + Intronic
1065631245 10:27683192-27683214 GTCCGTGGCCCGGGGATGGGGGG + Intronic
1068956022 10:62818946-62818968 GACCGGGGCTGGGGGCGGGGCGG + Intronic
1069708872 10:70476578-70476600 GTAGGGGGCTGAGGGCTTGGAGG - Intergenic
1069752320 10:70752446-70752468 GACCATGGCTGGGGGCTGGCAGG - Intronic
1069826667 10:71258892-71258914 GTACCTGGCTGGCCACTGGGCGG - Intronic
1070531655 10:77342505-77342527 GAATCTGGCTGGGGGTTGGGTGG - Intronic
1070705462 10:78634616-78634638 GCATGGGGCTGGAGGCTGGGAGG - Intergenic
1070929817 10:80253145-80253167 GGACGTGGATGAGGTCTGGGAGG - Intergenic
1071497546 10:86179268-86179290 GTCCGGGGCTGGGGCATGGGTGG - Intronic
1071509053 10:86249950-86249972 GTAGGTGAATGGGGGGTGGGTGG + Intronic
1071554441 10:86591613-86591635 GTGAGGGGCTGGGGGCTGGAGGG + Intergenic
1072565080 10:96610539-96610561 GTGGGTGGGTGTGGGCTGGGTGG + Intronic
1072986004 10:100141010-100141032 GTAGGTTACTAGGGGCTGGGAGG + Intergenic
1073178507 10:101570422-101570444 GGGCCTGGCTGGGGGCGGGGCGG - Intergenic
1073285111 10:102382789-102382811 GTAGGCAGGTGGGGGCTGGGTGG + Exonic
1073470390 10:103718477-103718499 GCAAAGGGCTGGGGGCTGGGGGG + Intronic
1074095107 10:110304751-110304773 GTGTGGGGCTGGGGGCGGGGCGG + Exonic
1074141769 10:110679759-110679781 GGGCTTGGCTGAGGGCTGGGAGG + Intronic
1074314660 10:112350099-112350121 GTGCGTGGCTTGGGACTGGCAGG + Intergenic
1074976877 10:118588202-118588224 GGACTTAGCTGGGGGCTGAGGGG + Intergenic
1075657613 10:124172621-124172643 TAACGGGGCTGGGGCCTGGGCGG + Intergenic
1075683729 10:124349884-124349906 GGGCTAGGCTGGGGGCTGGGTGG - Intergenic
1075970847 10:126650879-126650901 GCAGGTGGCTGGGGGGTGGAAGG - Intronic
1076097566 10:127744502-127744524 ATAGGAGTCTGGGGGCTGGGTGG - Intergenic
1076415697 10:130286719-130286741 GTGGGTGGCTGGAGGCTTGGTGG - Intergenic
1076603526 10:131674711-131674733 TGATGTGGCAGGGGGCTGGGAGG - Intergenic
1076777252 10:132704651-132704673 GTGCGTGGCTGGGCCGTGGGGGG + Intronic
1076833246 10:133007413-133007435 GTGCCTGGCTGGGGGCTGGGAGG - Intergenic
1077052998 11:576077-576099 CTACGTGCGTGGGGGCGGGGTGG + Intergenic
1077204871 11:1337288-1337310 GTGCGGGGCTGGGGGCTCCGAGG - Intergenic
1077326960 11:1968127-1968149 TTCCCTGGCTGGGGGCTGAGGGG - Intronic
1078845227 11:15114243-15114265 GGACGGGGGTGGGGGGTGGGGGG + Intronic
1079238514 11:18706325-18706347 GGACGGGGCTGGGGGGTCGGGGG - Intronic
1080470736 11:32543124-32543146 AAAAGAGGCTGGGGGCTGGGTGG + Intergenic
1080885347 11:36362848-36362870 CTGCATGGGTGGGGGCTGGGGGG + Intronic
1081755748 11:45543192-45543214 GAATGTAGCTGGGGGCTGAGAGG - Intergenic
1082006132 11:47420139-47420161 GTGTGTGCCTGGGGCCTGGGAGG + Intronic
1082990439 11:59202684-59202706 GTAAGTGGCTAGGGGCGGTGGGG - Intronic
1083156901 11:60828876-60828898 GGCTGTGGCTGGGGGCTGTGGGG - Intergenic
1083225432 11:61281667-61281689 GGGCGTGGCTGGGCGCCGGGAGG + Intronic
1083929825 11:65835324-65835346 GTAGGTGGGTAGGGGGTGGGAGG + Intronic
1084006599 11:66326605-66326627 GGATGGGGCTGGGGGCAGGGCGG - Intergenic
1084178947 11:67437187-67437209 GTGCAGGGCCGGGGGCTGGGGGG + Intronic
1084403066 11:68956103-68956125 GTGGGGGGCTGGGGGTTGGGGGG + Intergenic
1084496188 11:69505041-69505063 GCACATGGCTGGGAGGTGGGTGG - Intergenic
1084693188 11:70738828-70738850 GGACGTGGCTGGAGGCCGTGAGG - Intronic
1085024401 11:73228176-73228198 GTACGTGGGGTGGGGGTGGGGGG + Intronic
1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG + Intergenic
1088504343 11:110513900-110513922 GTAAGTGGCTGGAGGCAGGAAGG - Intergenic
1089144239 11:116312856-116312878 GAAAGGGGCTGGGGGCTGTGGGG + Intergenic
1089215193 11:116830652-116830674 GGACTGGGCTGGGGGCAGGGTGG + Intronic
1089927110 11:122270113-122270135 GGACTTGGCAGGGGGCTGAGAGG + Intergenic
1090358399 11:126156013-126156035 GAGCGTGGCTGTGGGCGGGGAGG - Intergenic
1090429968 11:126637463-126637485 GCAGGAGGCTGGAGGCTGGGAGG - Intronic
1090599852 11:128358802-128358824 ATGGGTGGCTGAGGGCTGGGAGG - Intergenic
1090996329 11:131869089-131869111 GCACATTGCGGGGGGCTGGGGGG - Intronic
1202809942 11_KI270721v1_random:23307-23329 TTCCCTGGCTGGGGGCTGAGGGG - Intergenic
1091383529 12:77955-77977 GTGCGAGGCTGGACGCTGGGAGG - Intronic
1091743566 12:2976786-2976808 GCCCGGGCCTGGGGGCTGGGTGG + Intronic
1091908267 12:4206821-4206843 GTTTGTGGGTGGGGGGTGGGCGG + Intergenic
1092236626 12:6814627-6814649 GTGCGCAGCTGGGTGCTGGGAGG + Intronic
1092405262 12:8217347-8217369 GAAGGTGGGTGGGGGCTGGCTGG + Intergenic
1092677366 12:10936138-10936160 GTATGTGTGTGGGGGCGGGGTGG - Intronic
1095206108 12:39442683-39442705 GCAGGTGGCTGGCGGCTGCGCGG - Intronic
1095403256 12:41839334-41839356 GTAGGTGCCTGGGAGTTGGGTGG - Intergenic
1096080034 12:48827066-48827088 GTCCGGGGCCAGGGGCTGGGTGG - Exonic
1096110295 12:49024783-49024805 GGAAGGGGCTGGGAGCTGGGGGG - Intronic
1096113036 12:49040291-49040313 ACACTTCGCTGGGGGCTGGGGGG - Exonic
1096518851 12:52173002-52173024 GGACGCGCCTGGGGGCGGGGAGG - Intronic
1096996874 12:55843602-55843624 CTAAGGGGCTTGGGGCTGGGGGG + Intergenic
1097146086 12:56940194-56940216 GTGAGTGGGTGAGGGCTGGGGGG + Intergenic
1097151803 12:56984671-56984693 GTGAGTGGGTGAGGGCTGGGGGG + Intergenic
1097178330 12:57156456-57156478 GTGGGTGGATGGGGGCTGGCAGG - Intronic
1097679822 12:62637976-62637998 GTCCCTGGTTGGGGGCGGGGGGG + Intergenic
1098324476 12:69287370-69287392 GTACTGGACTGGGGGCTGGGAGG + Intergenic
1098597959 12:72295126-72295148 GGGGGTGGCTGGGGGATGGGGGG + Intronic
1098898168 12:76085300-76085322 GGATGTGGCGGGGGGTTGGGGGG - Intergenic
1099131313 12:78835677-78835699 GGAGGAGGCTGGGGGATGGGAGG + Intergenic
1101148262 12:101862214-101862236 CTACTTGGCTGGGGGCTGGGGGG - Intergenic
1102017421 12:109657008-109657030 GCACTGGGCTGGGGGCTGTGTGG - Intergenic
1102251566 12:111390910-111390932 GTCTGTGGCAGGGGTCTGGGGGG - Intergenic
1102682619 12:114700704-114700726 GTACATGGACGGGGGTTGGGGGG + Intergenic
1103279245 12:119741601-119741623 GTATGTGTGTGGAGGCTGGGAGG + Intronic
1103563243 12:121803600-121803622 GGAGATGGCTGGGGTCTGGGGGG - Intergenic
1103730906 12:123027169-123027191 GTATGTGGCCAAGGGCTGGGTGG - Intronic
1103908764 12:124340535-124340557 GGAGGCGGCTGGGGGATGGGCGG - Intronic
1104506823 12:129339984-129340006 GTATGGGGCTGTGGGGTGGGAGG - Intronic
1104736230 12:131137454-131137476 GTACTTGGCTGGGGGGAGGTAGG + Intronic
1104814860 12:131639749-131639771 TTCCGTGGGTGGGTGCTGGGAGG + Intergenic
1104873100 12:132014738-132014760 GCACGTGGCTGGGGGAAGAGTGG - Intronic
1104972891 12:132539788-132539810 CTAGGTGGATGGGGGCTGGAGGG - Intronic
1104973053 12:132540238-132540260 CTAGGTGGATGGGGGCTGGAGGG - Intronic
1105702610 13:22944394-22944416 CTACTTGGCTGGGGGATGAGAGG - Intergenic
1105891476 13:24685434-24685456 GTGTGTGGCGGGGGGCTGTGTGG + Intronic
1106147807 13:27066385-27066407 GTATTTGGCTGGGAGCTGGGAGG - Exonic
1106235502 13:27857319-27857341 GAGCCTGGCTGGGGGCGGGGGGG + Intergenic
1106242812 13:27924194-27924216 CTGCGTGGGTGGGGGCTGTGCGG + Intronic
1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG + Intergenic
1108167222 13:47706438-47706460 GTAGGTGGTTGGGGGAAGGGGGG - Intergenic
1108820429 13:54342699-54342721 GTCCATGGATGGGGGCAGGGAGG - Intergenic
1108848524 13:54702069-54702091 GTTCTTGGGTGGGGGATGGGGGG + Intergenic
1113064502 13:106359806-106359828 GTACGTATGTGGGGGCAGGGAGG + Intergenic
1113157899 13:107346155-107346177 GTACTTTGTTGGGGGCGGGGGGG + Intronic
1113583770 13:111448796-111448818 GGGCGTGGCTGGGGGCCAGGTGG + Intergenic
1115820851 14:37211188-37211210 GTCCTTGTCTGGGGGGTGGGGGG - Intronic
1117315785 14:54569012-54569034 GGAGGAGGCTGGGGGATGGGGGG + Intronic
1117803980 14:59470940-59470962 GGGGGTGGCTGGGGGCGGGGGGG + Intronic
1119640609 14:76311616-76311638 GAACTTGGCTGGGGACTGGGAGG + Intronic
1121245488 14:92458602-92458624 CTACATGGCAGGGCGCTGGGAGG + Intronic
1121343411 14:93118024-93118046 GGATGAGGCTGGGCGCTGGGAGG + Intergenic
1121645818 14:95516573-95516595 GTAAGTGGCACGGGGCCGGGAGG - Intronic
1122778646 14:104134389-104134411 GGACGTGGATGGGGGTGGGGTGG + Intergenic
1123063669 14:105605750-105605772 GGGCCTGGCTGGGGGCTGGCAGG + Intergenic
1123105771 14:105840438-105840460 GTGGCTGGCTGAGGGCTGGGCGG + Intergenic
1124118488 15:26868152-26868174 GTCCCTGGCTCGGGGCTGAGGGG + Intronic
1124723948 15:32138438-32138460 GTGCTTGGGTGGGGGTTGGGAGG - Intronic
1125556614 15:40591025-40591047 TAACTTGGCTGGGGGCGGGGCGG + Intergenic
1126142739 15:45451051-45451073 GGAGGTGGGTGGGGGCTGAGGGG - Intergenic
1126837036 15:52678648-52678670 GTTTGGGGCTGGGGGCTGGGCGG - Intronic
1127236613 15:57059725-57059747 ATATGTGGTGGGGGGCTGGGGGG + Intronic
1127661657 15:61104998-61105020 CCACGTGGCTGGGCGGTGGGGGG - Intronic
1128892721 15:71345187-71345209 GCAAGTGGCGGGGGGTTGGGGGG + Intronic
1128991034 15:72260530-72260552 AGACCTGCCTGGGGGCTGGGAGG + Exonic
1129115703 15:73364276-73364298 GTGGGTGTCTGGGGGCTGTGTGG - Intronic
1129451536 15:75653765-75653787 GTTCTTGCCTGGGGGATGGGTGG + Intronic
1129960772 15:79682064-79682086 GATGGTGGCTGGGGGCTGCGTGG + Intergenic
1130688967 15:86063883-86063905 GTAGGTTGCTGGAGGGTGGGGGG + Intergenic
1131250729 15:90828358-90828380 GTGCGTGGATGGGGGCGGGGCGG + Intergenic
1131507300 15:93029905-93029927 GTCCTTGGCTGGGGAATGGGTGG + Intergenic
1132342468 15:101087069-101087091 GGAAGAGGGTGGGGGCTGGGGGG + Intergenic
1132549218 16:547474-547496 GGCCCTGGCTGGTGGCTGGGGGG - Exonic
1132555380 16:569848-569870 GTCCGGGCCTGGGGACTGGGCGG + Intronic
1132572518 16:650175-650197 GCCCGCGGCTGGGGGCTGCGTGG + Intronic
1132843630 16:1990258-1990280 GTAGGGGGCAGGGGGCTGGTAGG - Intronic
1132878188 16:2149394-2149416 GGACTTGGCAGGGGGCTGGGAGG + Intronic
1132976803 16:2715234-2715256 ATACATGGCAGAGGGCTGGGTGG + Intronic
1133069453 16:3235685-3235707 GTAGGGGGGTGGGGGTTGGGGGG - Intronic
1133421762 16:5652604-5652626 GTGAGTGGGTGGGGGCTGAGAGG - Intergenic
1133605789 16:7386374-7386396 GTTGGGGGGTGGGGGCTGGGGGG - Intronic
1133767663 16:8849096-8849118 GCACCTGGCTGTGGGCTGGGAGG - Exonic
1136497814 16:30654779-30654801 GGACGGGGGTGGGGGCTGTGGGG - Exonic
1137406338 16:48192497-48192519 GTATGGGCCTGGGTGCTGGGTGG - Intronic
1137516472 16:49148887-49148909 GAACTTGGTTGGGGGCAGGGGGG - Intergenic
1137632474 16:49956774-49956796 GGACAAGGCTGGGTGCTGGGTGG - Intergenic
1137665262 16:50246027-50246049 GCGGGGGGCTGGGGGCTGGGGGG - Intergenic
1137785299 16:51133389-51133411 GCCCGTGGCGGGGGGGTGGGTGG + Intergenic
1138537563 16:57668044-57668066 CTACGGGGCTAGGGGCTGGGTGG - Intergenic
1138561109 16:57801659-57801681 GTATGGAGGTGGGGGCTGGGTGG + Intronic
1139364964 16:66427432-66427454 GTAAGGGGCGTGGGGCTGGGCGG + Intronic
1140895319 16:79319557-79319579 GTAGGTGGAAAGGGGCTGGGGGG + Intergenic
1141082066 16:81061394-81061416 GAACGTTGCTGGGGTCTGGAGGG + Exonic
1141383018 16:83592747-83592769 ATTCGTGGCTGGGGGCTGGTGGG - Intronic
1141570617 16:84931469-84931491 GGAGGTGGCCCGGGGCTGGGAGG - Intergenic
1141649431 16:85385228-85385250 GTCCGGGGCAGGAGGCTGGGAGG + Intergenic
1142213179 16:88817984-88818006 GTAAGTGGCTGGTGTGTGGGCGG - Intronic
1142605285 17:1078037-1078059 GCAGCTGGCTGGGGGCTGGGGGG - Intronic
1142864072 17:2779782-2779804 GGACAAGGCAGGGGGCTGGGGGG + Intronic
1142875135 17:2847791-2847813 GGATGAGGCTGAGGGCTGGGTGG - Intronic
1142964698 17:3573303-3573325 GTGCTTGGCTGTGGTCTGGGTGG - Intronic
1143028348 17:3953809-3953831 GTCCGTGGTGGGGGTCTGGGCGG - Intronic
1143028496 17:3954398-3954420 GTATGTGGGGCGGGGCTGGGGGG - Intronic
1143171381 17:4932526-4932548 GAAGGGGGCTGGGGCCTGGGGGG + Intronic
1143478419 17:7215893-7215915 GCAGGCAGCTGGGGGCTGGGGGG - Intronic
1143573022 17:7772668-7772690 GTATGGGGCTGTAGGCTGGGAGG + Intronic
1143601415 17:7948545-7948567 CTACCAGGCTCGGGGCTGGGGGG + Exonic
1143623498 17:8094919-8094941 TCACGTGGCTGGGGGCTTTGCGG - Intergenic
1144435000 17:15232130-15232152 GTAGGTGGCCGGGCGGTGGGGGG - Intronic
1144781985 17:17812960-17812982 GTACCTGGCGGGGGCCTGGCGGG + Intronic
1144784363 17:17823666-17823688 GGGCGGGGCTGGGGGCGGGGCGG - Intronic
1146895662 17:36539944-36539966 TTATGTGTCTGGGGGCTGGGGGG + Intronic
1147212204 17:38878190-38878212 GTTCTGGGCAGGGGGCTGGGTGG + Intronic
1147840628 17:43369020-43369042 GCACGGGGCGGGGGGCTGGGCGG + Intergenic
1147995768 17:44359710-44359732 GTGCCTGGCTGGGGGGTAGGGGG - Intronic
1148441136 17:47712072-47712094 CTCTGTGGCTGGGGGCAGGGCGG + Intergenic
1148441380 17:47713368-47713390 GAAAGTTGCTGGGGGCTGGGAGG + Intergenic
1148688861 17:49515340-49515362 GTGGGTGGCTGGGAGCTGTGGGG - Intergenic
1148783915 17:50135945-50135967 GTACGTGGCTGGGGGCTGGGCGG - Intronic
1148864999 17:50623791-50623813 GCACGGGGGTGAGGGCTGGGCGG + Intronic
1149575239 17:57707278-57707300 GTACTTGTCTGGAGGCTGGGAGG - Intergenic
1150223085 17:63508115-63508137 GAGGGTGGTTGGGGGCTGGGAGG - Intronic
1151303938 17:73250920-73250942 GTGCTTGGCTGAGAGCTGGGAGG - Intronic
1151325716 17:73378843-73378865 GTATGGGGTTGGGGGCTGGTGGG + Intronic
1151426668 17:74035196-74035218 CTCCGTGGCTGTGGGCTGGGTGG - Intergenic
1151774849 17:76193537-76193559 GTCCGTGGGTGGGGGGTGGTGGG - Intronic
1151820470 17:76494116-76494138 GTGTGTTGCGGGGGGCTGGGGGG + Intronic
1151826937 17:76529049-76529071 TTGCGTGGGTGGGGGGTGGGGGG - Intronic
1151979962 17:77502890-77502912 GTAGGGGGCAGGGGGCTGGCTGG - Intergenic
1152110804 17:78356727-78356749 GCACGGGGCGGGGGGCGGGGGGG + Intergenic
1152219941 17:79058121-79058143 GTACGTGGCGGTGGGGTGGGTGG - Intergenic
1152626374 17:81389569-81389591 GTGAGTGGAGGGGGGCTGGGAGG + Intergenic
1152691404 17:81719745-81719767 GTGCCTGGCTGGTGCCTGGGAGG + Intronic
1153978793 18:10291947-10291969 GAACGTGGCTGGGGGCTGTGTGG - Intergenic
1153985685 18:10349040-10349062 GTACGTCCTTGGGGGCTGGGGGG + Intergenic
1154018230 18:10638725-10638747 GCACCTTGCTGTGGGCTGGGAGG - Intergenic
1154186641 18:12190857-12190879 GCACCTTGCTGTGGGCTGGGAGG + Intergenic
1155253882 18:23977924-23977946 TCAGGAGGCTGGGGGCTGGGTGG - Intergenic
1155333147 18:24738141-24738163 GTGTGGGGGTGGGGGCTGGGGGG + Intergenic
1155356443 18:24958196-24958218 GAACGTGGCTGAGGTATGGGAGG + Intergenic
1156187022 18:34675146-34675168 TTATTTGGCTGGGGGTTGGGGGG + Intronic
1156865694 18:41886447-41886469 GTGAGAGGCTGGGGGCTGGGGGG + Intergenic
1157701003 18:49761617-49761639 GTGCGTGTGTGGGGGGTGGGGGG - Intergenic
1158137519 18:54223995-54224017 GTACCTCCCTGGGGGCGGGGAGG - Intronic
1159117068 18:64127074-64127096 TTACTTGGCAGGGGGCGGGGAGG - Intergenic
1159189723 18:65026043-65026065 ATACATCGCTGGGGGGTGGGGGG - Intergenic
1160682389 19:417810-417832 AGGCCTGGCTGGGGGCTGGGTGG + Intronic
1160742847 19:695308-695330 GGACTTGGCGGGGGCCTGGGTGG + Intronic
1161064917 19:2232889-2232911 GAGTGTGGCTGGGGCCTGGGCGG - Intronic
1161095655 19:2389050-2389072 GAACGTGACTGCTGGCTGGGCGG - Intergenic
1161160155 19:2757308-2757330 GCATGGGGCCGGGGGCTGGGGGG - Intronic
1161258677 19:3323554-3323576 GGAGGTGGCGGGGGGGTGGGGGG + Intergenic
1161271908 19:3394517-3394539 GTAAGCGGGTGGGGGGTGGGTGG - Intronic
1161331316 19:3688942-3688964 GGATGGGGCTGGGGGGTGGGGGG + Intronic
1161400515 19:4065012-4065034 GAGCCTGGCTGGGGGCTGAGCGG - Intronic
1161830657 19:6601783-6601805 CTACGTGACTGGGGGCTGCAGGG - Intronic
1161959583 19:7516275-7516297 GGCCGGGGCGGGGGGCTGGGTGG + Intronic
1162016513 19:7849331-7849353 GTAGGTGGCTGGGGGGTGGCTGG + Intronic
1162953613 19:14086035-14086057 GTGAGGGGCTGGGGCCTGGGCGG - Intergenic
1163313812 19:16529644-16529666 GTACCAGGCTGGGTGGTGGGCGG + Exonic
1163553900 19:17982150-17982172 GACGGGGGCTGGGGGCTGGGGGG - Intronic
1163623524 19:18374644-18374666 GCACGGGGGTGGGGGCGGGGGGG + Intergenic
1163655437 19:18542929-18542951 TTATGGGGGTGGGGGCTGGGAGG - Intronic
1163655667 19:18543524-18543546 GGCCGCGGCTGGGGGCGGGGAGG - Exonic
1163748250 19:19060601-19060623 CGACGGGGATGGGGGCTGGGGGG - Intergenic
1163834085 19:19562832-19562854 GTCCCTGGCTGGGGGCTGCATGG + Intronic
1164733223 19:30521277-30521299 GTGCATGTCTGGGGGCTGTGGGG + Intronic
1164825266 19:31280456-31280478 GGACAGGGCTGGGGGCTGGGTGG - Intronic
1165780898 19:38433763-38433785 GGAGGGGGCTGCGGGCTGGGCGG - Intronic
1166666323 19:44682621-44682643 GTATGGAGCTGGGAGCTGGGAGG + Intronic
1166746035 19:45142288-45142310 GGCCGTGGCTGGGGACGGGGAGG - Exonic
1167074999 19:47243243-47243265 GCTCCGGGCTGGGGGCTGGGAGG + Intergenic
1167148241 19:47695031-47695053 GGGCGTGGCTGGGGGCAGTGGGG - Exonic
1167157865 19:47750345-47750367 TTCCGGGGCTGGGGGCTGGTAGG + Intronic
1167272021 19:48511307-48511329 GAGGGAGGCTGGGGGCTGGGTGG - Intronic
1167290118 19:48619844-48619866 CTCCGTGGCTTGGGGGTGGGGGG + Intronic
1167466232 19:49652227-49652249 GGAAGTGGCCGGGGGCGGGGAGG - Exonic
1167550076 19:50154416-50154438 GTACGGGGCAGGGGGCGGGAGGG + Intronic
1167610807 19:50506946-50506968 GAAGTTGGCTGGTGGCTGGGAGG - Intronic
1167631826 19:50630261-50630283 CCACCTGGCTGGGGGATGGGGGG - Intronic
1167665651 19:50821685-50821707 GTAGGGGCCTGGGGTCTGGGAGG - Intronic
1167665778 19:50822184-50822206 GTCTGGGGCTGGGGGATGGGAGG + Intronic
1168282604 19:55313427-55313449 GTCCGAGGCTGGCGGCAGGGAGG - Intronic
1168522118 19:57060803-57060825 GGACCTGGATGGAGGCTGGGCGG - Intergenic
925178893 2:1803925-1803947 GCACGTGCCTGGGGGCTCGCAGG - Intronic
925313831 2:2906858-2906880 GTGAGTGGCTGTGGGCCGGGGGG - Intergenic
925888830 2:8416816-8416838 GAAGGTGGCTGAGGGCTGGTAGG - Intergenic
925959928 2:9004299-9004321 GGACGAAGGTGGGGGCTGGGAGG + Intergenic
925964139 2:9047791-9047813 GTCCGTGGCTTGGGGGTTGGGGG - Intergenic
926146679 2:10400678-10400700 CTCCGTGGCTGAGGGCTGGAGGG - Intronic
926392687 2:12409906-12409928 GTACGTGTCTGGCTGATGGGAGG + Intergenic
926749372 2:16186243-16186265 GCACCTGGCTGGGGGCTGTAGGG + Intergenic
927095581 2:19745578-19745600 GCCAGTGGCTGGGGGCTGTGAGG + Intergenic
927812379 2:26187333-26187355 GTAGGGGACCGGGGGCTGGGCGG - Exonic
928582182 2:32719873-32719895 ATATTTGGCTGGGGGATGGGAGG - Intronic
928661073 2:33502296-33502318 GGAGGTGGGTGGGGGTTGGGGGG + Intronic
929766129 2:44845340-44845362 GTGTGTGTTTGGGGGCTGGGTGG + Intergenic
930372106 2:50514990-50515012 GTACCTGTCTGTGGCCTGGGGGG - Intronic
931241967 2:60461784-60461806 GGACTTGACCGGGGGCTGGGAGG + Exonic
933726564 2:85430645-85430667 GTACCTGGGTGAGGGCTAGGAGG + Intronic
934515000 2:94980997-94981019 GCCCGAGGCTGGGGGCTGGCTGG - Intergenic
934768606 2:96894401-96894423 GTGAGTGGGTGGGGGGTGGGAGG - Intronic
935223546 2:101035002-101035024 GCAGGAGGTTGGGGGCTGGGGGG + Intronic
936064203 2:109318319-109318341 GGACCGGGCTGGGGGCCGGGAGG - Intronic
937228243 2:120382079-120382101 GTGCGTGGCTGTGTCCTGGGAGG + Intergenic
937300348 2:120835352-120835374 GTGACTGGCTGGGGCCTGGGAGG - Intronic
937362013 2:121236149-121236171 TTATGTGGATGGGCGCTGGGGGG + Intronic
937450914 2:122001442-122001464 CCACGGGTCTGGGGGCTGGGAGG - Intergenic
937991389 2:127664283-127664305 GTAGGTGGCCAGGGGCGGGGCGG - Intronic
938157458 2:128953299-128953321 ATGGGTGGCTGGGGGCGGGGAGG + Intergenic
939952199 2:148488647-148488669 GTGCGGGGGTGGGGGGTGGGGGG + Intronic
941229819 2:162897917-162897939 GGGCCTGGATGGGGGCTGGGTGG - Intergenic
941621932 2:167788266-167788288 GGAAGTGGGTGGGGGCGGGGGGG + Intergenic
944815544 2:203372580-203372602 GGACGGGGCGGGTGGCTGGGCGG + Intronic
945028030 2:205637905-205637927 GAACCTGGCTGGGTGCTGTGCGG - Intergenic
945119548 2:206443702-206443724 GCGCGGGGCTCGGGGCTGGGCGG - Exonic
945984262 2:216341403-216341425 GAATGTGGGTGGGGTCTGGGCGG - Intronic
946140348 2:217685123-217685145 GTATGTGTGTGGGGGCTGGAGGG + Intronic
946140456 2:217686112-217686134 GTATGTGTGTGGGGGCTGGAGGG - Intronic
947769862 2:232662143-232662165 TTTCCTGGCTGGGGGCTGGGGGG + Intronic
947866200 2:233399540-233399562 GTACGTGGCTGTGGGGTGGAAGG + Intronic
948690408 2:239699012-239699034 GTTAGGGGCTGGGGGCTGGGGGG - Intergenic
948777043 2:240294656-240294678 GTTGTTGGCAGGGGGCTGGGGGG - Intergenic
949014063 2:241699672-241699694 GGATGTGGCTGGGGGTGGGGCGG + Intergenic
1168812012 20:710389-710411 GCGCGTGTCTGGGGGCTGGGTGG - Intergenic
1169214534 20:3785653-3785675 GTACTTGGCCAGGGCCTGGGTGG + Exonic
1169483071 20:6002602-6002624 GTGCGGGGCAGGGGGGTGGGGGG + Intergenic
1170234321 20:14085015-14085037 CTACTTGGTTGGGGGGTGGGGGG + Intronic
1171796472 20:29570318-29570340 CTACGTGGGCGGAGGCTGGGAGG + Intergenic
1171851771 20:30313851-30313873 CTATGTGGGTGGAGGCTGGGAGG - Intergenic
1171986658 20:31665658-31665680 GTTTGTGGCTGGGGGCAGGAGGG - Exonic
1172195755 20:33090436-33090458 CTACGTTGGTGGGGGCAGGGGGG - Intronic
1172762159 20:37330523-37330545 GGACGTGGGTGGAGGCAGGGAGG - Intergenic
1172874733 20:38157209-38157231 GGAGGGGGCTGGGGGCTGGGAGG - Intronic
1173279903 20:41618617-41618639 GCACGAGGCAGGGGGCGGGGCGG - Intergenic
1173571043 20:44076318-44076340 GTAGGTGGCGGGGGGGGGGGGGG - Intergenic
1174130241 20:48339473-48339495 GTGTGTGGCGGGGAGCTGGGGGG - Intergenic
1174816623 20:53692652-53692674 GAACGAGGCGGGTGGCTGGGCGG - Intergenic
1175484976 20:59339353-59339375 GAAGGTGGCAGGGGGCTGGATGG - Intergenic
1175519074 20:59588124-59588146 GTAAGTGGCTGAGGGCTGCTTGG + Intronic
1175691174 20:61067089-61067111 GAAAGGTGCTGGGGGCTGGGTGG + Intergenic
1176064810 20:63188888-63188910 GTGCTTGGGTGGAGGCTGGGCGG - Intergenic
1176132351 20:63501701-63501723 GTGCGGGGATGGGGGCTGCGGGG + Intergenic
1176141419 20:63546713-63546735 GGCAGGGGCTGGGGGCTGGGAGG - Intronic
1176281651 20:64316833-64316855 GTGCGAGGCTGGACGCTGGGAGG + Intergenic
1176964552 21:15197268-15197290 GTGCGTGGTTGAGGGCAGGGAGG - Intergenic
1177524469 21:22273873-22273895 GTAGGTGGCTGGGGGAGGGATGG + Intergenic
1178418048 21:32419800-32419822 GAGCGGGGGTGGGGGCTGGGGGG + Intronic
1178480662 21:32977122-32977144 GGAAGTTGCTGGGGGCTGCGGGG - Intergenic
1178974411 21:37209013-37209035 GGATGGGGGTGGGGGCTGGGGGG + Intergenic
1179162906 21:38912578-38912600 GTGGGTGCCGGGGGGCTGGGGGG + Intergenic
1179494681 21:41764139-41764161 CTAAGTGTCTGGGGGCTGGGCGG + Intronic
1179828830 21:43983440-43983462 GTGCGAGGCTGGGGGGTGGGGGG - Exonic
1180199931 21:46218095-46218117 GTGCGGGGGTGGGGGGTGGGGGG - Intronic
1180790770 22:18574341-18574363 GTAGCTTGCTGGGGGCTGGAGGG - Intergenic
1180791266 22:18576975-18576997 GTGCGTGGTTGGGGGGGGGGGGG - Intergenic
1181048354 22:20227160-20227182 GTGCATAGCTGGGGGCAGGGTGG + Intergenic
1181230967 22:21420973-21420995 GTAGCTTGCTGGGGGCTGGAGGG + Intronic
1181247681 22:21513896-21513918 GTAGCTTGCTGGGGGCTGGAGGG - Intergenic
1181248178 22:21516530-21516552 GTGCGTGGTTGGGGGGGGGGGGG - Intergenic
1181670604 22:24424026-24424048 GTCCGGGGCTGGTGGCCGGGCGG + Intronic
1181769788 22:25117137-25117159 AAACCTGGATGGGGGCTGGGAGG - Intronic
1182563482 22:31180101-31180123 GAACATGGCGGGGGGGTGGGGGG + Intronic
1182696913 22:32204202-32204224 GCCCTTGGCTGGGGGCTGGTTGG - Intergenic
1182766234 22:32760160-32760182 GTACGTGGGTGCTGGCTGGGGGG - Intronic
1183099599 22:35575624-35575646 GTGGGTGGCTGGGGTTTGGGGGG + Intergenic
1183282084 22:36937504-36937526 GGGCCTGGCTGGGGGCTGGGGGG - Exonic
1183543285 22:38442094-38442116 GCAGGTGGCTGGGGACAGGGTGG + Intronic
1183721841 22:39567274-39567296 GTCCGAGGGTGGAGGCTGGGTGG + Intergenic
1184070391 22:42143221-42143243 GTGCGAGTCTGTGGGCTGGGAGG - Intergenic
1184110162 22:42389614-42389636 GTTGGGGGCTGGGGTCTGGGAGG + Intronic
1184201392 22:42971860-42971882 GAACGGGGCTGCTGGCTGGGCGG - Intronic
1184381233 22:44146058-44146080 GTGCGTGACTGGGGGAAGGGAGG - Intronic
1184453627 22:44597162-44597184 GAACGTGGCTGGGGGAGGGAGGG + Intergenic
1184875304 22:47270513-47270535 GTAATTGGCTGGGGGGTAGGGGG + Intergenic
1185248968 22:49789669-49789691 GTAGGTGGTTGGGGGAAGGGGGG - Intronic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185322734 22:50209352-50209374 CCACGTGGCTGGGGGCTGTTGGG + Intronic
950143397 3:10630834-10630856 GTTTGTGGCGGGGGGGTGGGGGG + Intronic
950484121 3:13262876-13262898 GGAAGTGGCTGGGGGAGGGGAGG + Intergenic
950572684 3:13811766-13811788 GTGCATTGCTGGGGGCTGGTAGG - Intergenic
952899300 3:38098993-38099015 GGATGGGGCTGGGGGCAGGGTGG + Intronic
953960224 3:47260797-47260819 GTGCCTGGGTGGGGCCTGGGAGG + Intronic
953974477 3:47371691-47371713 GATCCTGGCTGGTGGCTGGGAGG + Intergenic
954054758 3:48012655-48012677 GTGTGTGGCTGGGGGCGGGGTGG - Intronic
954149177 3:48648663-48648685 GCAGGAGGCTGGGAGCTGGGGGG + Intronic
954462799 3:50637249-50637271 GTCCCTGGCTGGGGCCTGGCAGG - Intronic
954714569 3:52520699-52520721 GTACAGGGCTAGGGGCTGAGTGG + Intronic
955507014 3:59642299-59642321 GTCCGAGGCCGGGGGCGGGGAGG + Intergenic
955937291 3:64113650-64113672 AGTGGTGGCTGGGGGCTGGGTGG - Intronic
956167569 3:66408033-66408055 CCACGTGGATGGGGGCAGGGAGG - Intronic
961117100 3:124339757-124339779 GTAGGGGGCTGAGGGCTGAGAGG + Intronic
961208941 3:125110393-125110415 GCAGGTGGGTGGGTGCTGGGGGG - Intronic
962259697 3:133895007-133895029 GCAGGTGGCTGGGTGCTGGCGGG - Intronic
963002209 3:140692646-140692668 GTAATTGGCTGGAGGCTGGCAGG - Intronic
964763650 3:160157836-160157858 GCAGATGGCTGGGGGCTGGCCGG + Intergenic
965994406 3:174862313-174862335 GGACATGGCTGGGAGATGGGAGG + Intronic
966355517 3:179074465-179074487 GTGTGTGGCTGGTGGGTGGGTGG - Intergenic
966432976 3:179852009-179852031 GGACGAGGCTGGGGACTGTGAGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967955886 3:194876903-194876925 CCACCTGGCTGGGGGCTTGGGGG + Intergenic
968547411 4:1206104-1206126 GTACTGGGCTGGGGGCTGTCAGG + Intronic
968586442 4:1418919-1418941 GCACTTGGATAGGGGCTGGGAGG - Intergenic
968915632 4:3495997-3496019 CCTCGTGGGTGGGGGCTGGGAGG - Intronic
969125534 4:4945216-4945238 GGAAGTGGCTGGGGGCCGGGAGG + Intergenic
969606282 4:8203873-8203895 GAACGTGGCAGGGGACTGGGAGG - Intronic
969632733 4:8347784-8347806 GCACATGGCAGGGGGGTGGGTGG + Intergenic
969760852 4:9180624-9180646 GAAGGTGGGTGGGGGCTGGCTGG - Intergenic
972589397 4:40470217-40470239 GTACCAGGCTGGGGGGCGGGGGG - Intronic
973703755 4:53561697-53561719 ATACGTGGCTGAAGGCTGGCTGG - Intronic
975784980 4:77877894-77877916 GCAACTGGCTGGGGGGTGGGGGG + Intronic
979754594 4:124325329-124325351 GTACGTGTGTGTGGGCAGGGAGG - Intergenic
981874944 4:149530797-149530819 GTATGTGGGGGGGGGGTGGGGGG - Intergenic
983313725 4:166099087-166099109 GTCCATGTCTGGGGCCTGGGTGG + Intronic
985126675 4:186701620-186701642 GCAAGTGGCTGAGAGCTGGGTGG - Intronic
985539589 5:481886-481908 GTGCGGGGCTGGGGGGCGGGGGG - Intronic
985539646 5:482041-482063 GTGCGGGGCTGGGGGGCGGGGGG - Intronic
985595179 5:784755-784777 GGGCGGGGCTGGGGGCGGGGCGG - Intergenic
986171485 5:5318178-5318200 GTGCCTGGCTGGGGGCCGGCCGG + Exonic
986270428 5:6225467-6225489 GAACGAGGCTGGGAGCTGTGTGG - Intergenic
986978870 5:13423271-13423293 GTATGGGGCTGGGTGCTGAGAGG - Intergenic
987089291 5:14497122-14497144 GCACGGGGCTGGTGGGTGGGAGG - Intronic
988276910 5:29092273-29092295 GTACATGACTGGGGGCTGCATGG - Intergenic
989257025 5:39376951-39376973 GTGCATGGATGGGGGCTGAGTGG + Exonic
989983238 5:50667250-50667272 GTCTGTGGCTGGGGGTGGGGTGG + Intronic
992539118 5:77744368-77744390 ATACTTTGCTGGGGGCAGGGAGG - Intronic
992910718 5:81393914-81393936 GGCGGCGGCTGGGGGCTGGGGGG - Intronic
993511188 5:88773371-88773393 GTACGAGGATGGGGGATGGTGGG - Intronic
997829862 5:137140544-137140566 GCCGGGGGCTGGGGGCTGGGAGG - Intronic
1001489358 5:172144773-172144795 GTACGTGCCATGGGGCCGGGTGG + Intronic
1003212276 6:4078923-4078945 GTGCGTGGCTGACGGCTTGGAGG + Exonic
1003673936 6:8185467-8185489 GTCGGTGGGTGGGGGCTGAGGGG - Intergenic
1004478722 6:15998948-15998970 GGACGGGGGTGGGGGGTGGGTGG + Intergenic
1004815805 6:19310690-19310712 GGTGGGGGCTGGGGGCTGGGTGG + Intergenic
1006155200 6:32009926-32009948 GCCCGGGGCCGGGGGCTGGGTGG - Intergenic
1006161506 6:32042660-32042682 GCCCGGGGCCGGGGGCTGGGTGG - Intronic
1006614614 6:35318011-35318033 CTAGGTGGCTTGGGTCTGGGTGG + Intronic
1006700459 6:35968777-35968799 GTAAGGGGCTGGGGGCGGGGGGG - Intronic
1007046330 6:38778712-38778734 TGACATGGCTGGGGGCAGGGAGG - Intronic
1007390372 6:41546890-41546912 GGACGTGGGTGGGGGCTGGGCGG + Intronic
1007396474 6:41580864-41580886 GAACGTGGCTGGGAGGTGCGTGG - Intronic
1008434716 6:51462106-51462128 GTATGTGTGTGGGGGGTGGGGGG + Intergenic
1010465696 6:76165493-76165515 ATTCGTGGTTGGGGGCTGGAGGG - Intergenic
1011217556 6:85020969-85020991 GTTGGTGGCTGGGGGATGAGAGG + Intergenic
1013458882 6:110357407-110357429 GGCGTTGGCTGGGGGCTGGGAGG - Intronic
1013479644 6:110542985-110543007 GTATGGGGTTGGGGGCTGGGGGG + Intergenic
1014072385 6:117197941-117197963 GTAGGTGGCTGGTGGGTTGGTGG + Intergenic
1014260156 6:119207246-119207268 TTCCGTGGTTGGGGGTTGGGGGG - Intronic
1019643833 7:2118656-2118678 GTATGTGGGCAGGGGCTGGGAGG - Intronic
1019666395 7:2254130-2254152 GTGCGTGACGGGAGGCTGGGAGG + Exonic
1019774276 7:2903182-2903204 GTGGCTGGCTGGGGGCTGGGTGG - Intergenic
1019994759 7:4717038-4717060 GCACGTGGCTGGGAGGTGGCTGG + Intronic
1020428432 7:8095245-8095267 GTGGGGGGCTGGGGGGTGGGGGG + Intergenic
1021303110 7:18996831-18996853 GTGTGTGGCTGGGAGGTGGGGGG - Intronic
1021590041 7:22251277-22251299 GTACGTGAGTGGTTGCTGGGGGG - Intronic
1021690101 7:23223061-23223083 GTTCCTGTCTGGAGGCTGGGTGG - Intergenic
1022507502 7:30915934-30915956 GGGAGGGGCTGGGGGCTGGGTGG + Intronic
1023191670 7:37589758-37589780 GTAGGAGGGTGGGGGTTGGGAGG + Intergenic
1023259272 7:38341812-38341834 GTGTGTGGCGGGGGGCGGGGGGG + Intergenic
1023500526 7:40844590-40844612 GTACAGGGTTGGGGGCAGGGTGG + Intronic
1023965429 7:44961319-44961341 TGAGGGGGCTGGGGGCTGGGGGG + Intergenic
1024302319 7:47896646-47896668 GTACCTGGCTGTGTGCTGGGGGG - Intronic
1024576759 7:50770669-50770691 GCAGGTGGCAGGGGGATGGGGGG + Intronic
1026100883 7:67383735-67383757 GTGTGTGGCTGGTGGCTGAGAGG + Intergenic
1027189720 7:75989585-75989607 GGAGGTGGCAGGGAGCTGGGGGG - Intronic
1027266843 7:76499168-76499190 GTGTGTGGATGGGGGTTGGGGGG + Intronic
1027318660 7:76999028-76999050 GTGTGTGGATGGGGGTTGGGGGG + Intergenic
1027723818 7:81777206-81777228 GTACGGGGCCGAGGGTTGGGGGG + Intergenic
1029504242 7:100952606-100952628 ATTAGTGGCTGTGGGCTGGGAGG - Exonic
1030469228 7:109941801-109941823 GTATGTGACTGGGGGCTGCAGGG - Intergenic
1030817089 7:114051521-114051543 GAAGGTGGGTGGGGGCGGGGGGG + Intronic
1031519573 7:122747203-122747225 GTGGGTGGCTGGGTGTTGGGGGG - Intronic
1032077057 7:128840971-128840993 GTAAGTGGCTGGGGGGCAGGAGG + Intronic
1032703067 7:134398936-134398958 CTTGGTGGCTGGGGGGTGGGGGG - Intergenic
1033047521 7:137976228-137976250 GCACATGCCTGGTGGCTGGGTGG - Intronic
1034536472 7:151728813-151728835 GGACGGGGCTGGGCGCTGGTGGG - Intronic
1034636999 7:152575500-152575522 GTAAGAGGCTGGAGTCTGGGAGG - Intergenic
1036270961 8:7302475-7302497 GAAGGTGGGTGGGGGCTGGCTGG - Intergenic
1036350388 8:8007869-8007891 GAAGGTGGGTGGGGGCTGGCTGG + Intergenic
1037705895 8:21314713-21314735 GCAGGAGGCTGGGGGCGGGGAGG + Intergenic
1037813986 8:22102384-22102406 GCAGGTGGTTGGGGGCTGGAGGG + Intronic
1039097804 8:33905255-33905277 GGATGTGGCTGGGGTCAGGGTGG - Intergenic
1039864516 8:41489900-41489922 GGATGTGGATGGGAGCTGGGTGG + Intergenic
1039902292 8:41761872-41761894 GGTTGTGGGTGGGGGCTGGGAGG - Intronic
1042467082 8:69140547-69140569 GGAGGTGGCAGGGGGCAGGGAGG + Intergenic
1042906611 8:73778235-73778257 GTCATTGGCTGGGGGCTGTGTGG + Intronic
1044821537 8:96158981-96159003 GCTCGGGGCTGGGGGCGGGGGGG + Intronic
1045776963 8:105815980-105816002 GTGGGTGGCTGGGGGTGGGGTGG - Intergenic
1047047666 8:121073071-121073093 GTATTGGGCTGGGGGGTGGGTGG - Intergenic
1048089670 8:131225429-131225451 GTAAGAGGGTGGAGGCTGGGAGG + Intergenic
1048506314 8:135025462-135025484 GTACTTGGCTGGGGTATGGAGGG + Intergenic
1048965076 8:139609240-139609262 GTAGGTGGGGGGGGGGTGGGGGG - Intronic
1049097864 8:140559354-140559376 ACACCTGGCTGAGGGCTGGGAGG - Intronic
1049217188 8:141413576-141413598 GTGGGAGGCTGGGGGCAGGGAGG + Intronic
1049657349 8:143804692-143804714 GAATGTGGCAGAGGGCTGGGAGG + Exonic
1049765929 8:144355195-144355217 GCATGTGGGTGGGGGGTGGGAGG - Intronic
1049861619 8:144902440-144902462 GGGCGGGGCTGGGGGCTGCGTGG + Intergenic
1051361346 9:16284427-16284449 GCACGTTGCTGGGTGCTAGGGGG - Intergenic
1053593083 9:39533525-39533547 GCACGGGGCTGGGTCCTGGGCGG - Intergenic
1053850820 9:42288233-42288255 GCACGGGGCTGGGTCCTGGGCGG - Intergenic
1054573223 9:66831752-66831774 GCACGGGGCTGGGTCCTGGGCGG + Intergenic
1056585339 9:87924278-87924300 GTGGGGGGCGGGGGGCTGGGGGG + Intergenic
1056611542 9:88128662-88128684 GTGGGGGGCGGGGGGCTGGGGGG - Intergenic
1057030117 9:91769046-91769068 TTGCGTGGCTGTGGGCCGGGCGG + Intronic
1057786487 9:98091956-98091978 GTACCTGGCTTGGTGCTGGAAGG + Exonic
1058437302 9:104974868-104974890 GTCGGGGGCTGGGGGCGGGGAGG + Intergenic
1058661615 9:107272351-107272373 GGACGTGGCGGCTGGCTGGGCGG - Intergenic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1061049427 9:128185720-128185742 GTGTGAGGCTGGGGGCTGCGAGG + Exonic
1061462195 9:130748964-130748986 GGTCATGGCTGAGGGCTGGGAGG - Intronic
1061780784 9:132994961-132994983 GTCCGTGGATTGGGGCTCGGGGG + Intergenic
1061905176 9:133693006-133693028 CTTCGGGGCTGGGGGCTGGCAGG - Intronic
1061929791 9:133826635-133826657 CTAGGTGGCTGGGGGAGGGGTGG - Intronic
1062023075 9:134328243-134328265 GGACGTGGCAGGGGCCTGGCTGG + Intronic
1062030039 9:134358129-134358151 GCAGGTGGCCGGGGCCTGGGTGG - Intronic
1062263996 9:135678469-135678491 GGCTGTGGCTGGGGGGTGGGTGG + Intergenic
1062339227 9:136086528-136086550 GACCGTGGCTGGGTGCTGGCAGG - Intronic
1062376787 9:136265412-136265434 GCACATGCATGGGGGCTGGGAGG - Intergenic
1062502026 9:136855751-136855773 CCCCGAGGCTGGGGGCTGGGAGG + Exonic
1062538792 9:137032424-137032446 GTAGCTGGGTGGGGGCTGGGGGG - Exonic
1062584314 9:137242025-137242047 AGCCGTGGCTGGGGACTGGGCGG + Intronic
1062649701 9:137569311-137569333 GAAGGTGGGTGGGGGGTGGGTGG - Intronic
1185503974 X:618952-618974 CTGCGTGGCTGGGGGCGTGGGGG + Intergenic
1185534600 X:850845-850867 GTGCGGTGCTGGGGGCAGGGTGG - Intergenic
1187483133 X:19676346-19676368 CTACCTGGGTGGGGGCTGGGTGG + Intronic
1188006313 X:25017849-25017871 GTCCGCGGCTGGAGGCTAGGAGG - Intergenic
1188745687 X:33839769-33839791 GCACGTGGCTGGAGGGTGGCAGG - Intergenic
1189318034 X:40069556-40069578 GTAGATGGCTGGGGGCCTGGAGG - Intronic
1189330090 X:40139112-40139134 ATAAGGTGCTGGGGGCTGGGAGG + Intronic
1190010938 X:46784126-46784148 GTACGTGTATTGGGGCTGTGGGG - Intergenic
1190310428 X:49113587-49113609 GTACCAGCCTGGGGGATGGGAGG + Exonic
1192178097 X:68898488-68898510 GTAAGTGGCTTTGGGATGGGTGG + Intergenic
1192229789 X:69256923-69256945 GGACAGGGCTGGGGGCTAGGAGG + Intergenic
1193782605 X:85722220-85722242 TTAGGTGGCCGGGGGCGGGGGGG - Intergenic
1194134039 X:90116625-90116647 GTATTTGGCTGGGAGCTGGGAGG + Intergenic
1195086108 X:101416157-101416179 GGACGAGGCGGGGGGCGGGGGGG - Intergenic
1196746966 X:119079739-119079761 CTCCGTGGCTGGGGGATGAGTGG + Exonic
1197147337 X:123184782-123184804 GTGCGGGGCGGGGGGCGGGGCGG + Intronic
1197708273 X:129649111-129649133 GTACTTGGCTGGGGGGCAGGAGG + Intronic
1197765486 X:130057118-130057140 GGGGGTGGCTGAGGGCTGGGAGG - Exonic
1199696033 X:150343125-150343147 GAACATGGCTGGGAGCTAGGTGG + Intergenic
1200479818 Y:3686740-3686762 GTATTTGGCTGGGAGCTGGGAGG + Intergenic
1201291149 Y:12421476-12421498 GGGCGCGGCTGGGGGCCGGGGGG - Intergenic