ID: 1148785412

View in Genome Browser
Species Human (GRCh38)
Location 17:50143872-50143894
Sequence CTTTGCCAAGTCTACTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148785408_1148785412 13 Left 1148785408 17:50143836-50143858 CCACAACTGAAGAAGGGATATAG 0: 1
1: 0
2: 2
3: 21
4: 227
Right 1148785412 17:50143872-50143894 CTTTGCCAAGTCTACTAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 101
1148785402_1148785412 30 Left 1148785402 17:50143819-50143841 CCCCATTAGGGGATGTCCCACAA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1148785412 17:50143872-50143894 CTTTGCCAAGTCTACTAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 101
1148785407_1148785412 14 Left 1148785407 17:50143835-50143857 CCCACAACTGAAGAAGGGATATA 0: 1
1: 0
2: 0
3: 67
4: 787
Right 1148785412 17:50143872-50143894 CTTTGCCAAGTCTACTAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 101
1148785404_1148785412 28 Left 1148785404 17:50143821-50143843 CCATTAGGGGATGTCCCACAACT 0: 1
1: 1
2: 1
3: 1
4: 55
Right 1148785412 17:50143872-50143894 CTTTGCCAAGTCTACTAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 101
1148785403_1148785412 29 Left 1148785403 17:50143820-50143842 CCCATTAGGGGATGTCCCACAAC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1148785412 17:50143872-50143894 CTTTGCCAAGTCTACTAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148785412 Original CRISPR CTTTGCCAAGTCTACTAGGA TGG Intronic
903578017 1:24351212-24351234 CTTTGCAAAGTCTTCTACAAAGG - Intronic
907172844 1:52487143-52487165 CTTTGCTAAGTCTTCAAGCAAGG - Intronic
907852346 1:58267616-58267638 CTTTGCTAAATCTCCTGGGATGG + Intronic
909034327 1:70580183-70580205 CTTTGTCAAGTCTCCCTGGAAGG + Intergenic
911714204 1:101111772-101111794 CTCTGCCATCTCTCCTAGGAAGG + Intergenic
917346157 1:174030198-174030220 TTTTGCCAAGTTTACCAGGCTGG - Intergenic
921669502 1:217910585-217910607 CTTTGCCAAATCAAAGAGGAGGG + Intergenic
921986025 1:221313267-221313289 CTTTGTCCAGTCTACCATGATGG + Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
924234393 1:241988460-241988482 CATTGCCAAGTCTACTTGGCTGG - Intergenic
1063015676 10:2074746-2074768 CTTTGAGAAGTCAACCAGGAAGG - Intergenic
1064316185 10:14259811-14259833 CTTTGCCATGGCTGTTAGGATGG + Intronic
1065178335 10:23100140-23100162 CTTTGCCAAAGCTAAGAGGAGGG + Intronic
1065593722 10:27291887-27291909 CTTTGCCATGTTCACTGGGAGGG - Intergenic
1067687337 10:48474695-48474717 CTTTTTCTAGTCTACTAAGACGG + Intronic
1068827536 10:61455847-61455869 CTTTCTCAAGCCTACTAGGAAGG + Intergenic
1077724748 11:4662947-4662969 CTTTGCCAGGTATACAAAGAAGG + Intergenic
1078946842 11:16077564-16077586 CTTTATCAAGTCTACTATGACGG - Intronic
1079199573 11:18364333-18364355 TTTTGCCAAGTCTGGGAGGATGG - Intronic
1079201629 11:18382074-18382096 CTTTTCCAAATCTCCTTGGAGGG - Intergenic
1079659141 11:23018324-23018346 CTTTGCCAAGGTGACCAGGAGGG - Intergenic
1079770210 11:24449018-24449040 ATTTGCTAAGTTTACTAAGATGG - Intergenic
1084386108 11:68843590-68843612 CTTTGCCAATCCTAAAAGGAGGG + Intronic
1093095843 12:14971317-14971339 CTTTCTCAAGTGTACTGGGATGG + Intergenic
1093297690 12:17411198-17411220 CTCTACCAAGCCTACTAAGAGGG + Intergenic
1095563198 12:43589889-43589911 CTTTGCCAAGTTTACCAGTTAGG + Intergenic
1096860224 12:54521159-54521181 CTTGGCCAACTCTTCCAGGAAGG - Exonic
1097883739 12:64708786-64708808 TTTTGCCAAATCTATTAGGCGGG - Intergenic
1099046576 12:77728096-77728118 CATGGCTATGTCTACTAGGATGG - Intergenic
1106108534 13:26756916-26756938 CTTTGTCAAGTCTCCTATGGTGG + Exonic
1107168002 13:37305591-37305613 CTTGGCCAAATCTACTTGTAAGG + Intergenic
1107598684 13:41990596-41990618 GTTTACCAACTCTACTGGGACGG - Intergenic
1114064152 14:19046254-19046276 CTTTGCCATGTCACCTAGGCTGG - Intergenic
1114098107 14:19353742-19353764 CTTTGCCATGTCACCTAGGCTGG + Intergenic
1115471014 14:33768698-33768720 CTTTGGCAAGTCTTCTAGCTTGG - Intronic
1125096222 15:35855324-35855346 CTTTTCCAACTCTGCCAGGAAGG - Intergenic
1126195866 15:45930688-45930710 CTTTGCCACATCTATTAGGATGG + Intergenic
1126701025 15:51367659-51367681 CTTTGCTAAGTGGATTAGGATGG - Intronic
1127011199 15:54631148-54631170 CTTTGCCACGTTGACTAGGCTGG - Exonic
1130668901 15:85892969-85892991 TTTTGATAAGTCTACTAGGTTGG + Intergenic
1131386567 15:92013163-92013185 CTTTGACAAGTCTAGAAAGATGG - Intronic
1138117117 16:54369625-54369647 CTTTGCCCAGATTACAAGGAAGG + Intergenic
1138288157 16:55825479-55825501 CTTTGCCAAGACAATTAGGGAGG + Intronic
1142256271 16:89015258-89015280 CTTTGCCTAGGCCACTAGCAGGG + Intergenic
1148167854 17:45496106-45496128 CCTTGCCAGGTTTACCAGGAAGG - Intergenic
1148280969 17:46346849-46346871 CCTTGCCAGGTTTACCAGGAAGG + Intronic
1148303197 17:46564784-46564806 CCTTGCCAGGTTTACCAGGAAGG + Intronic
1148785412 17:50143872-50143894 CTTTGCCAAGTCTACTAGGATGG + Intronic
1149748664 17:59124232-59124254 TTTTGCCATGTTTACTAGGCTGG - Intronic
1150399032 17:64842518-64842540 CCTTGCCAGGTTTACCAGGAAGG - Intergenic
1152884490 17:82841502-82841524 TTTTGCCATGTTTCCTAGGATGG + Intronic
1161935975 19:7372529-7372551 CTTTGCCAAGGCTAGAAGTAGGG + Intronic
1162786138 19:13036174-13036196 ACTTCCCAAGTCTCCTAGGAAGG + Intronic
1168360724 19:55737786-55737808 CATTGCCAGGTCTACTGAGATGG - Intronic
929919828 2:46164091-46164113 CTTTCCCAGCTCTGCTAGGAAGG - Intronic
931791923 2:65671436-65671458 CTTTGCCAGGGATACAAGGAAGG + Intergenic
932226216 2:70043106-70043128 TGATGCCAAGTCAACTAGGAAGG + Intergenic
938481417 2:131665243-131665265 CTTTGCCATGTCACCTAGGTTGG - Intergenic
940329481 2:152458614-152458636 CTTTACCAAGTATTTTAGGATGG - Intronic
942154170 2:173109979-173110001 GGTTGCCTAATCTACTAGGAAGG - Intronic
948695608 2:239731764-239731786 CTGTGCCAAGGCTGCTGGGAAGG + Intergenic
1168863300 20:1061893-1061915 CTTTCCCCATTCTACTAGGTTGG + Intergenic
1173458885 20:43225824-43225846 CTCTGCCAATTCTTCTGGGATGG - Intergenic
1177226096 21:18258246-18258268 CTTTGCAAAGACTTCCAGGAGGG - Intronic
1177266411 21:18790384-18790406 CTTGGCCAAGTCTATAATGATGG + Intergenic
1177383880 21:20382973-20382995 CTTTGTCCAGTCTACTGTGATGG - Intergenic
1177775620 21:25562543-25562565 CTTTGCAAAGTTTCCTTGGATGG + Intergenic
1180482644 22:15768888-15768910 CTTTGCCATGTCACCTAGGCTGG - Intergenic
1182313216 22:29424332-29424354 CATGGCCAAGGCTTCTAGGATGG + Intergenic
955999851 3:64717680-64717702 ATTTGCCAAGTGTCCTATGAGGG + Intergenic
957971219 3:87385058-87385080 CTTTGCCCACTCTAATAGGTGGG + Intergenic
961931152 3:130534199-130534221 TTTTGGCCAGTCTAATAGGAAGG + Intergenic
962700631 3:137996312-137996334 CTTTGCCAATTCTCCTACCATGG - Intergenic
974982969 4:68984148-68984170 CTTGGCCAAGTCTCCTAACATGG - Intergenic
977432378 4:96946594-96946616 CTATGCAAAGTCTACAAGGAAGG + Intergenic
979160768 4:117458153-117458175 CTGTGACTAGTCTACTAAGAAGG - Intergenic
984086622 4:175321304-175321326 ATTTGCCAAGTCTTATAGTATGG + Intergenic
985815770 5:2126642-2126664 CTTTGCCAGGGCTACTGAGAAGG + Intergenic
987147783 5:15009217-15009239 CTTTCCCAAGTCCACTATCATGG - Intergenic
988543146 5:32130542-32130564 CCTTCCCAAGTCAAATAGGAAGG + Intronic
989823429 5:45824195-45824217 CTTTGTCAACTCTAATAGCAGGG + Intergenic
992243676 5:74795305-74795327 GTTTGCCAAGTCTAGCAGGCAGG - Intronic
994050707 5:95359371-95359393 CTTTTCCAAGAATTCTAGGAAGG + Intergenic
996397785 5:123031137-123031159 TTTTGCCAACTCTACTGGAAAGG + Intronic
998438241 5:142132574-142132596 CTTTTTCAAGTCTCCTGGGATGG + Intronic
1005023167 6:21436883-21436905 CTTAGCCAAGACTAGAAGGATGG + Intergenic
1005578528 6:27212029-27212051 CTTAGCCAAGGCTACAAGGAAGG + Intergenic
1010605327 6:77882667-77882689 CTTTGTGTAGTCTACCAGGAAGG + Intronic
1010955860 6:82090257-82090279 TTTTGCCAAGTCACCTAGGCTGG - Intergenic
1012355806 6:98312563-98312585 CTTGGCAAAGTGCACTAGGAAGG - Intergenic
1017893594 6:158659756-158659778 CTTTGCCTTGGCTACCAGGAAGG + Intronic
1018053693 6:160033545-160033567 CTTGCCGAAGTCTACTAGGAAGG - Intronic
1020164223 7:5795634-5795656 TTTTGCCATGTTTACTAGGCTGG - Intergenic
1021656067 7:22875148-22875170 GTTTGCCAAGGCCACTAGGGTGG + Intergenic
1023509500 7:40935929-40935951 ACTTGACTAGTCTACTAGGAAGG - Intergenic
1024037247 7:45518054-45518076 CTTTGGCAATTCTACTAGAATGG - Intergenic
1027512827 7:79104469-79104491 CTTTACCATGTTTGCTAGGATGG - Intronic
1029246084 7:99202647-99202669 TTTTGCCATGTTTACCAGGAGGG - Intronic
1030048869 7:105521321-105521343 CTTTGCCAACCCTACTCGGCAGG + Intronic
1031293216 7:119966095-119966117 ATTTGCTAAGTGTAATAGGAAGG + Intergenic
1035897873 8:3424688-3424710 CTTTGCCATTTCTATCAGGAAGG + Intronic
1037164198 8:15807128-15807150 CTTTGCCAAGTGGACTTGAAAGG - Intergenic
1039686428 8:39807110-39807132 CTTTTCCAGGTCTACTGGGAGGG - Intronic
1041868788 8:62609505-62609527 CTTTGCCAAGTATTCTTGTAGGG + Intronic
1044312816 8:90713859-90713881 ATTTGCCAATTCTACTACCATGG + Intronic
1045602858 8:103737530-103737552 CTTTCATACGTCTACTAGGATGG + Intronic
1047582177 8:126228063-126228085 CTTTTACAGGTCTACTATGAAGG - Intergenic
1048423849 8:134304367-134304389 CTTTGCTAAGTCTACTTAGTTGG - Intergenic
1052935532 9:34089808-34089830 CTTTTCCAAGGCTTCTTGGATGG - Intronic
1058121185 9:101140815-101140837 CTCTGTCTAGTCTAGTAGGAAGG + Intronic
1189373292 X:40446758-40446780 CTTTGCCAAGCCCACCAGCATGG + Intergenic