ID: 1148786972

View in Genome Browser
Species Human (GRCh38)
Location 17:50150321-50150343
Sequence CAAAAGTATGTTCCTGCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 8, 3: 19, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148786972_1148786975 -7 Left 1148786972 17:50150321-50150343 CCATCTGCAGGAACATACTTTTG 0: 1
1: 0
2: 8
3: 19
4: 204
Right 1148786975 17:50150337-50150359 ACTTTTGATGCGGTGGACGTTGG 0: 1
1: 0
2: 0
3: 3
4: 38
1148786972_1148786981 24 Left 1148786972 17:50150321-50150343 CCATCTGCAGGAACATACTTTTG 0: 1
1: 0
2: 8
3: 19
4: 204
Right 1148786981 17:50150368-50150390 TTCTTGTGGTGGGCCCCCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 63
1148786972_1148786978 14 Left 1148786972 17:50150321-50150343 CCATCTGCAGGAACATACTTTTG 0: 1
1: 0
2: 8
3: 19
4: 204
Right 1148786978 17:50150358-50150380 GGAGCCATATTTCTTGTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 137
1148786972_1148786976 10 Left 1148786972 17:50150321-50150343 CCATCTGCAGGAACATACTTTTG 0: 1
1: 0
2: 8
3: 19
4: 204
Right 1148786976 17:50150354-50150376 CGTTGGAGCCATATTTCTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1148786972_1148786980 23 Left 1148786972 17:50150321-50150343 CCATCTGCAGGAACATACTTTTG 0: 1
1: 0
2: 8
3: 19
4: 204
Right 1148786980 17:50150367-50150389 TTTCTTGTGGTGGGCCCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 85
1148786972_1148786977 13 Left 1148786972 17:50150321-50150343 CCATCTGCAGGAACATACTTTTG 0: 1
1: 0
2: 8
3: 19
4: 204
Right 1148786977 17:50150357-50150379 TGGAGCCATATTTCTTGTGGTGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148786972 Original CRISPR CAAAAGTATGTTCCTGCAGA TGG (reversed) Exonic
900842485 1:5065556-5065578 CAAAATTATTTTACTGCTGATGG - Intergenic
901248185 1:7750220-7750242 CCAAAGAAGGTTCTTGCAGAAGG + Intronic
904920383 1:34003359-34003381 CAAAACTATGTTACCACAGAGGG - Intronic
905063068 1:35156151-35156173 GAAAAGTAGGTTCCTGGATAAGG + Intergenic
905380193 1:37556467-37556489 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
907264003 1:53244251-53244273 CAAAATAGTCTTCCTGCAGAAGG + Intergenic
908096649 1:60746496-60746518 CAAAAATCTGTTTCTGGAGAGGG + Intergenic
908168938 1:61485700-61485722 CAGAAGTATGTTTATGAAGATGG + Intergenic
912205399 1:107502835-107502857 CAAAAGTTTGTTTCTGCTGTGGG - Intergenic
914384761 1:147157796-147157818 CAAAAGCCTTTTGCTGCAGAAGG + Exonic
917142388 1:171849486-171849508 CAAAAGTAAGTTGAGGCAGATGG + Intronic
917840682 1:178975038-178975060 CAATTTGATGTTCCTGCAGAGGG - Intergenic
919961256 1:202471875-202471897 CAGAAGGATGTTCCTTCAGGAGG - Intronic
921444464 1:215228710-215228732 CAAAAGTATTTTAATGCACAAGG + Intronic
921788055 1:219256526-219256548 CAAAAGTTTGTTCTTTCAAAAGG - Intergenic
921956697 1:220992456-220992478 CTAAAATATGTCCCAGCAGATGG - Intergenic
922054745 1:222030349-222030371 CACAAGTATGTGTTTGCAGAAGG + Intergenic
922482738 1:225950501-225950523 CAGGAGCAGGTTCCTGCAGATGG - Intergenic
923815206 1:237369826-237369848 CAAAAGTAAGATACTGAAGATGG - Intronic
1063760923 10:9075323-9075345 CAAAAGTATTCTACTACAGAAGG - Intergenic
1068479632 10:57574211-57574233 CAAAAGAATGTTGCTGTAGATGG - Intergenic
1068921323 10:62487727-62487749 TAAAAGGATGTTACTGCAGTTGG + Intronic
1071452327 10:85809493-85809515 AAAAAGTATGTTCCTTTAAAAGG + Intronic
1073642612 10:105268460-105268482 CAAAATTATCTTCCTCCTGAAGG - Intergenic
1073968035 10:109013928-109013950 CATAAGAATGTGTCTGCAGAGGG + Intergenic
1074932011 10:118137785-118137807 AAAAAGTATGCACCTACAGATGG - Intergenic
1077324964 11:1959696-1959718 AAACAGGCTGTTCCTGCAGAAGG + Intronic
1077711176 11:4538618-4538640 CATAGGGTTGTTCCTGCAGAAGG + Intergenic
1079712047 11:23697235-23697257 CAAGGGTATCTTCCTGCAAATGG - Intergenic
1080162493 11:29193955-29193977 TAAAAGTATGTTGCTGTTGAAGG + Intergenic
1080350976 11:31385793-31385815 CAATTTGATGTTCCTGCAGAGGG - Intronic
1081510562 11:43768560-43768582 CCAGAGTTTGTTCCTCCAGATGG + Intronic
1082188954 11:49218464-49218486 TAAAAATATCTTCCTGCAGAAGG - Intergenic
1082689391 11:56281326-56281348 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1083080770 11:60090777-60090799 TAGAAGTATGTTCCTGGAGTTGG - Intronic
1086677569 11:89628163-89628185 AAAAAATATCTTCCTGCAGAAGG + Intergenic
1089236813 11:117035809-117035831 CAGAAGGATGTTCCTTCAGGAGG - Intronic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1091161760 11:133429131-133429153 CAAAATTAGCTTCCTGGAGAGGG - Intronic
1202807946 11_KI270721v1_random:14875-14897 AAACAGGCTGTTCCTGCAGAAGG + Intergenic
1091780518 12:3211675-3211697 CAGAAGGATGTTCCTTCAGGAGG - Intronic
1093744331 12:22722435-22722457 CAGAAGAATGTTCCTTCAGGAGG + Intergenic
1093804202 12:23411863-23411885 CAAATGGGTGCTCCTGCAGAGGG + Intergenic
1095485353 12:42678882-42678904 CAGAAGGATGTTCCTTCAGGAGG - Intergenic
1095699539 12:45176545-45176567 CATAAGTATGTTCTTTAAGAAGG - Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097786048 12:63760370-63760392 CAGAAGAATGTTCCTTCAGATGG - Intergenic
1098864102 12:75742237-75742259 CACCAGTATGGTCCTGCAGCTGG + Intergenic
1100886020 12:99071018-99071040 CAGGAGTAGGTTCCTGGAGAAGG - Intronic
1101061093 12:100972812-100972834 CAGAAGTGTGTTCTGGCAGAAGG - Intronic
1103364541 12:120371604-120371626 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
1107042518 13:35964592-35964614 AAAAAGTATGTTCTAGCAAATGG - Intronic
1107237561 13:38191232-38191254 CAAAACTGTGTTCCTGCTGCAGG + Intergenic
1108576910 13:51798789-51798811 AAAATGGATGTTCCAGCAGAAGG - Intronic
1109304260 13:60621268-60621290 CATAAATATGTTCCTCTAGAAGG - Intergenic
1109862620 13:68220287-68220309 GAAAAGTAAGTTCCAGCAAATGG + Intergenic
1110899493 13:80802913-80802935 CAAATGGATATTTCTGCAGAAGG + Intergenic
1110958824 13:81594053-81594075 GAAAAATATGTTCTTGCAGTGGG - Intergenic
1114811841 14:25909918-25909940 CAAAAGTATCTCCCTGCACATGG - Intergenic
1119774972 14:77242667-77242689 AAAAAGGCTTTTCCTGCAGAGGG + Intronic
1120642422 14:87031287-87031309 GAAAAGAATTTTCTTGCAGAAGG + Intergenic
1120680202 14:87471935-87471957 CAAATGTATGTTCAAGCATAGGG - Intergenic
1122255005 14:100470165-100470187 GGAAAGTAGGTTCTTGCAGATGG + Intronic
1122471453 14:101969735-101969757 CAAATTTATCTTGCTGCAGATGG - Intronic
1124188826 15:27553651-27553673 AAAAATTATGTTCGTACAGATGG + Intergenic
1124351002 15:28955693-28955715 CACTCATATGTTCCTGCAGATGG - Intronic
1125887734 15:43241089-43241111 CTCCAGCATGTTCCTGCAGATGG - Intronic
1126238316 15:46411197-46411219 TAACAGTAAGTTCCTGGAGAAGG - Intergenic
1128711025 15:69872112-69872134 CAAGTGGCTGTTCCTGCAGAGGG - Intergenic
1130978272 15:88793869-88793891 AGAAAGTATCTTCCTGCTGAGGG + Intergenic
1130982689 15:88823615-88823637 CCAAAGCATGTGCCTGTAGAAGG - Intronic
1131088673 15:89601077-89601099 CAAAAGCATCTTCATGCAGTTGG - Intronic
1131298291 15:91171913-91171935 CAGAAGGATGATTCTGCAGATGG - Intronic
1135247160 16:20866880-20866902 CAAAAGTATTTTCCCAGAGAAGG - Intronic
1135484147 16:22849203-22849225 CACGAGTGTGTTCCTGTAGAGGG - Intronic
1136090464 16:27916032-27916054 CAAGGGCATGTTTCTGCAGAAGG - Intronic
1136772571 16:32854764-32854786 CCTAAGTAAGTTTCTGCAGATGG + Intergenic
1136898043 16:34006755-34006777 CCTAAGTAAGTTTCTGCAGATGG - Intergenic
1138316140 16:56072166-56072188 AAAGAGTAGGTTCCTGCAGGAGG + Intergenic
1139211671 16:65083753-65083775 CAACATTATGTGCCTCCAGAGGG + Intronic
1139708124 16:68756075-68756097 CTAAAGATTCTTCCTGCAGAGGG + Intronic
1140323121 16:73973175-73973197 AAAAAGTCTGTGCCTGCATATGG - Intergenic
1141841647 16:86577670-86577692 CAAAAGTAAGGTCCTCCTGATGG - Intronic
1203074996 16_KI270728v1_random:1116874-1116896 CCTAAGTAAGTTTCTGCAGATGG + Intergenic
1143748857 17:9013787-9013809 GAAAAGGATGTTGCTCCAGATGG - Intergenic
1144094062 17:11883954-11883976 CAAAAGTATTTTCCAGAAGGTGG - Intronic
1144170370 17:12654152-12654174 AAAATGTATGTGACTGCAGATGG - Intergenic
1148786972 17:50150321-50150343 CAAAAGTATGTTCCTGCAGATGG - Exonic
1153060526 18:990388-990410 CAAAATGCTGTTCCTGCAGCAGG + Intergenic
1153328873 18:3851504-3851526 CAAAAGAATGTTCCTGTAGAGGG - Intronic
1155972447 18:32093908-32093930 CAAAAGAATGTTCGGGCAGGTGG + Intronic
1156199820 18:34818106-34818128 CAAAAGTATGAACCAGAAGAAGG - Intronic
1157475825 18:48022834-48022856 CTAAAGAATTTTCCAGCAGAGGG - Intergenic
1157717157 18:49895765-49895787 CCAAACCATGCTCCTGCAGATGG + Intronic
1157891283 18:51420480-51420502 CCAAAATAAGTTCCTGCAAAAGG + Intergenic
1159577884 18:70201915-70201937 CAAAAGTAATTTCCAGCAGATGG - Exonic
1161502612 19:4624989-4625011 CAGGAGTGTGTTCCAGCAGAGGG - Intergenic
1162154578 19:8668645-8668667 CAAAAGCATGCACGTGCAGAAGG - Intergenic
1164264245 19:23597558-23597580 CAGAAGGATGTTCCTTCAGGAGG + Intronic
1167883725 19:52483503-52483525 CAATAGGATGTTCCTGCAGATGG - Intronic
1167884625 19:52489983-52490005 CAATAGGATGTTTCTGCAGATGG - Intronic
1167887006 19:52508463-52508485 CAATAGGATGTTCCTGCAGATGG - Intronic
1167889986 19:52531572-52531594 CAATAGGATGTTCCTGCAGATGG - Intronic
1167893592 19:52562473-52562495 CAATTGGATGTTCCTGCAGATGG - Intronic
1167911724 19:52709144-52709166 CAATAGGATGTTCCTGCAGTTGG + Intronic
1167914599 19:52730488-52730510 CAATAGGATGTTCCTGCAGATGG + Intronic
1167919431 19:52770738-52770760 AATAAGGATGTTCCTGCAGTTGG + Intronic
1167989778 19:53348545-53348567 CAATAGGATGTTCCTGCAGATGG - Intronic
1167993272 19:53378809-53378831 CAATAGGATGTTCCTGCAGATGG - Intronic
927477672 2:23426241-23426263 CAAATAAATGTTCCTGCAGGAGG - Intronic
928640686 2:33295709-33295731 TAAAAGTATGTTCTAGCAAAGGG + Intronic
932158524 2:69439347-69439369 CCAGAGTCTGTTCCTTCAGATGG + Intergenic
937192283 2:120114670-120114692 CAAAAGTATGTATCTGCTAATGG - Intronic
938588191 2:132712308-132712330 CCAAAGTATCTTCCTGAAGGGGG - Intronic
938744294 2:134262412-134262434 CAAAAGTTTTTTTCTGAAGATGG + Intronic
939729028 2:145758644-145758666 CAACCTTATGTTACTGCAGAAGG - Intergenic
941243927 2:163073212-163073234 CCAGAGTTTGTTCCTTCAGATGG - Intergenic
943135176 2:183901639-183901661 CAAAAGTGTGTTCATTCAGTTGG - Intergenic
943768580 2:191690525-191690547 TAAAAGAATGTCCCTCCAGAGGG + Intronic
945557622 2:211298947-211298969 CAGAAGGATGTTCCTTCAGGAGG - Intergenic
945582285 2:211610357-211610379 CAAAATACTGTTCCTGCAGGAGG - Intronic
947455664 2:230251605-230251627 AAAAAGTATCTACCAGCAGAGGG - Intronic
948529829 2:238597301-238597323 TGAAAGTATGTTCCTGCAAACGG - Intergenic
1169502955 20:6178708-6178730 GAAAAGTGTTTTCCAGCAGAGGG + Intergenic
1169838981 20:9913099-9913121 CTAAAGCATGTTCCAGCAGGAGG - Intergenic
1170171765 20:13421765-13421787 TAAGAGAATGTTCTTGCAGATGG - Intronic
1174199592 20:48798068-48798090 CAAAAGTGAGTTCATGCAAAAGG - Intronic
1175032681 20:55971340-55971362 CAAGAATATGTTCCTGGATATGG - Intergenic
1177889439 21:26787962-26787984 CATAAGTATGGTTCTCCAGATGG + Intergenic
1178251645 21:31009059-31009081 AAAAATTATGTTCTTGTAGAAGG - Intergenic
1178727880 21:35071106-35071128 TAAATGTCTGTTCTTGCAGAAGG - Intronic
1180286049 22:10745600-10745622 CAAGAGTATGATCCAGCAGTGGG - Intergenic
1182226459 22:28802231-28802253 CAAAACTATGTCCCTTTAGAGGG - Intergenic
1184378013 22:44126988-44127010 CAAAAGGATGTGCCTTGAGAGGG - Intronic
1184402815 22:44283675-44283697 CAAATGTATGTGCATGCAAAAGG + Intronic
1184956526 22:47890626-47890648 TAAAAATAAGTTTCTGCAGAAGG + Intergenic
949195712 3:1304231-1304253 CAAAAGTATGATCCTGAAAGAGG - Intronic
949204832 3:1425386-1425408 GAAATGTTTGTTCCTGAAGATGG + Intergenic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
953199099 3:40761765-40761787 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
954981785 3:54752465-54752487 CTTAAATATGTTCCTGCAGATGG + Intronic
955468611 3:59262694-59262716 CAAAAGTACTTTAGTGCAGAAGG + Intergenic
958096313 3:88950032-88950054 CAATTGTCTGTTCCTTCAGATGG + Intergenic
958876450 3:99623016-99623038 CAAAAGTATGGTACTGGACAGGG + Intergenic
960607253 3:119519411-119519433 GAAAAGGATGTTCATGCAAATGG + Intronic
965845502 3:172956327-172956349 TTATAGTATTTTCCTGCAGATGG - Intronic
965960460 3:174423085-174423107 AAAAGGTAAGTGCCTGCAGAGGG - Intergenic
969856948 4:10007634-10007656 CAAAAGAATGTTCCAGCAGGAGG - Intronic
971781594 4:31042023-31042045 CACTAGTATCTTGCTGCAGAGGG - Intronic
974091591 4:57316902-57316924 GAAAAGTATTTTTCTGCAGTAGG + Intergenic
974512562 4:62863695-62863717 CAATAGTATGCTTCTCCAGATGG + Intergenic
976334494 4:83869943-83869965 CAAGAGTAGGATGCTGCAGATGG - Intergenic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
980004743 4:127528682-127528704 GCCAAGTATGTTCTTGCAGAAGG - Intergenic
981034967 4:140160035-140160057 CAGAAGTTTGTTGCTGCAGAGGG + Intergenic
982858996 4:160424612-160424634 CAAAAGCAGGTTTGTGCAGAGGG - Intergenic
983790989 4:171796662-171796684 CAAAAGAATTTTGCTGCAGCAGG - Intergenic
985731047 5:1549133-1549155 CAAATGTGGGTTCCTGCACAAGG - Intergenic
985901487 5:2798736-2798758 CAACAGTTTGTTCCTGCAGCAGG + Intergenic
986848776 5:11785894-11785916 GAAGAGTCTGTTCCTGCAGCAGG - Intronic
987800688 5:22692537-22692559 CAAACATATGCTCCTGTAGAAGG + Intronic
988136724 5:27181710-27181732 CAATATTATGTTCCTGCTGCTGG - Intergenic
988882994 5:35524295-35524317 CAAAAGTATGTTCATGGTAATGG + Intergenic
989995178 5:50820637-50820659 CCAAAGTCTTTTCCTGCACATGG + Intronic
991718047 5:69470102-69470124 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
993804776 5:92392013-92392035 GAATACTATGTTCCTGCACATGG + Intergenic
994611197 5:102042615-102042637 CACAATAATGTTCCTACAGAAGG + Intergenic
995203666 5:109454695-109454717 CCACAGTCTGTTCCTGCAGTAGG + Intergenic
995983312 5:118135419-118135441 CAATAGTATGCTCTAGCAGATGG - Intergenic
997559211 5:134831273-134831295 CAAAAATGTCTTCCTGAAGAAGG + Intronic
998967712 5:147558797-147558819 CACAAGAATGTTCTTGTAGATGG + Intergenic
1002280419 5:178126681-178126703 CTAAGGGAAGTTCCTGCAGAAGG + Intergenic
1005142714 6:22652072-22652094 CAAAAGTATGTTCGTAAAGATGG + Intergenic
1007726544 6:43920169-43920191 CAAATGAATGTTTCTGGAGACGG + Intergenic
1008112494 6:47507913-47507935 CAAAAGAATCTTTCTGCAGTAGG + Intronic
1009535977 6:64886657-64886679 CAGAAATATGTTGCTGCACATGG + Intronic
1011788662 6:90874287-90874309 CAAAAATATTTTCCTTTAGAAGG + Intergenic
1011863408 6:91789290-91789312 GAAGAGTATGTTCTTGCATAAGG - Intergenic
1012034643 6:94118296-94118318 CAAAAAAATGTTGCTTCAGATGG - Intergenic
1014117611 6:117683690-117683712 AAAAAGTCTGTTTCTGTAGAAGG + Intronic
1015253653 6:131153576-131153598 CAAAAATAAGTTGCTACAGATGG + Intronic
1018995076 6:168704315-168704337 CAATAGTCTGTGCCTGCGGAGGG - Intergenic
1020089146 7:5328355-5328377 AAAAATTATTTTCGTGCAGATGG - Intronic
1022211974 7:28219866-28219888 TAAAAGTATTTTCCTGTAAAAGG + Intergenic
1022486858 7:30785809-30785831 CAAAAGTAAGCCCATGCAGACGG + Exonic
1023964429 7:44955443-44955465 CAGAAGAATAATCCTGCAGATGG - Intergenic
1024806100 7:53142386-53142408 CAATAGTATTTTTCAGCAGATGG + Intergenic
1024951592 7:54866762-54866784 CATAAGTAAGTTCCTACATAAGG - Intergenic
1024970538 7:55065748-55065770 CAAAAGCATGTTAGTGAAGAGGG - Intronic
1025205166 7:56988786-56988808 AAAAAATATTTTCATGCAGATGG + Intergenic
1025666772 7:63588148-63588170 AAAAAATATTTTCATGCAGATGG - Intergenic
1025907410 7:65798481-65798503 CAAAAGTATGTTAGGGAAGATGG + Intergenic
1026238058 7:68545948-68545970 TAAACGTATGTTCCTGCAGAAGG - Intergenic
1028758019 7:94460529-94460551 CAACATTATGTACCTCCAGATGG + Intergenic
1031765498 7:125772302-125772324 CAAGGATATTTTCCTGCAGATGG - Intergenic
1034535600 7:151724082-151724104 CAAAGGTATGGTGCTCCAGAGGG - Intronic
1034846109 7:154446896-154446918 CAAAAGAAAGTTCATGGAGAAGG + Intronic
1036126050 8:6063338-6063360 CTAAAGTTTAGTCCTGCAGAGGG - Intergenic
1037208407 8:16354585-16354607 CACAAGAATGGTCCTGGAGATGG + Intronic
1039261487 8:35776650-35776672 CAAAAAAATTTTCCTGGAGATGG - Intronic
1039612230 8:38929063-38929085 GAAAAGAATGTGCCTGCAGAGGG - Intronic
1040402787 8:47069346-47069368 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1043220004 8:77649672-77649694 CAAAAGTGTGTTCATGCTGGAGG + Intergenic
1043231046 8:77801050-77801072 AAAAAGTATGTTCAGGCAGAAGG - Intergenic
1043307747 8:78818152-78818174 CAAATTGATGTTTCTGCAGAGGG + Intergenic
1044964984 8:97565899-97565921 CAAAAGATTGTTCCAGCAGCTGG - Intergenic
1045406464 8:101871499-101871521 CTGAAGTAAGTGCCTGCAGATGG - Intronic
1047176439 8:122545306-122545328 CAAAAGACTCTTCCTGCCGATGG + Intergenic
1048707222 8:137167229-137167251 AAAAAGTATGTTCAGGCAGGAGG - Intergenic
1049030703 8:140035445-140035467 CCAAACTAAGTACCTGCAGAGGG + Intronic
1051573428 9:18585855-18585877 AAAAAGTATTTTCCTGCATCTGG - Intronic
1051972503 9:22907494-22907516 CTAAAGTGTGTTTTTGCAGATGG - Intergenic
1052297484 9:26913866-26913888 AAAAAGTATGTACCTGTAAATGG + Exonic
1052415812 9:28175668-28175690 CAAAAGCATATTCCTGGATAGGG - Intronic
1056106614 9:83353375-83353397 CTAAAGAATGTTCCTTCACAGGG + Intronic
1056904555 9:90634053-90634075 CAAGTGTAAGTTCCTGCTGAGGG + Intronic
1056971878 9:91211612-91211634 AAAAAGTGTGTACCTGCACATGG - Intergenic
1057064454 9:92035743-92035765 TAAAAGTATCTGCCTGAAGAGGG + Intronic
1059557675 9:115297747-115297769 AACAAGTACGTTCATGCAGATGG - Intronic
1188719695 X:33507072-33507094 CATAAGTATCTTTCTCCAGAGGG - Intergenic
1192022672 X:67410463-67410485 TTAAAGTATGTTACTGCTGAGGG - Intergenic
1192668637 X:73115898-73115920 TAAAACTATCTTGCTGCAGACGG - Intergenic
1193860759 X:86663990-86664012 CAAAAGTTATTTTCTGCAGATGG + Intronic
1195001858 X:100649979-100650001 AAACAGTATGTTCCACCAGACGG - Intronic
1195822625 X:108963542-108963564 TAAATGTATGTTCATGCTGATGG + Intergenic
1196021220 X:110992857-110992879 CTCAAGTATTTTCCTGCGGAAGG - Intronic
1196271275 X:113714534-113714556 CAAAAGCATGATCCTTCAAAAGG - Intergenic
1198118200 X:133565097-133565119 AACAAATATGTTTCTGCAGATGG + Intronic
1198940851 X:141953440-141953462 CAAATGGATGTTTCTGCAGCAGG + Intergenic
1201672189 Y:16536222-16536244 GAAAAGTATGTACTTGCATAGGG - Intergenic
1201999595 Y:20137726-20137748 CCAGAGTTTGTTCCTTCAGATGG + Intergenic
1202628546 Y:56884917-56884939 CAAGAGTATGATCCAGCAGTGGG + Intergenic