ID: 1148788089

View in Genome Browser
Species Human (GRCh38)
Location 17:50155738-50155760
Sequence CCCAGCACGCAGGTGGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148788081_1148788089 13 Left 1148788081 17:50155702-50155724 CCAGAACACCAGCTCTCAGGTCT No data
Right 1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG No data
1148788082_1148788089 5 Left 1148788082 17:50155710-50155732 CCAGCTCTCAGGTCTCCCACGCT No data
Right 1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG No data
1148788079_1148788089 16 Left 1148788079 17:50155699-50155721 CCTCCAGAACACCAGCTCTCAGG No data
Right 1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG No data
1148788083_1148788089 -10 Left 1148788083 17:50155725-50155747 CCCACGCTCAGTGCCCAGCACGC No data
Right 1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148788089 Original CRISPR CCCAGCACGCAGGTGGCTTT GGG Intergenic
No off target data available for this crispr