ID: 1148791747

View in Genome Browser
Species Human (GRCh38)
Location 17:50177092-50177114
Sequence GAGGAAAAGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791747_1148791761 28 Left 1148791747 17:50177092-50177114 CCAGCCTCCTTCTCCTTTTCCTC No data
Right 1148791761 17:50177143-50177165 CACAACTAGCCCCTCACTGCAGG No data
1148791747_1148791754 -7 Left 1148791747 17:50177092-50177114 CCAGCCTCCTTCTCCTTTTCCTC No data
Right 1148791754 17:50177108-50177130 TTTCCTCTGCTGGGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791747 Original CRISPR GAGGAAAAGGAGAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr