ID: 1148791859

View in Genome Browser
Species Human (GRCh38)
Location 17:50177792-50177814
Sequence CGCTAGTCAAAGAACCCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791859_1148791866 23 Left 1148791859 17:50177792-50177814 CCAAACGGGTTCTTTGACTAGCG No data
Right 1148791866 17:50177838-50177860 TATTTCTTTCTTTCTCCTGAAGG No data
1148791859_1148791863 -1 Left 1148791859 17:50177792-50177814 CCAAACGGGTTCTTTGACTAGCG No data
Right 1148791863 17:50177814-50177836 GGGTGCCTCTGGCTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791859 Original CRISPR CGCTAGTCAAAGAACCCGTT TGG (reversed) Intergenic
No off target data available for this crispr