ID: 1148791862

View in Genome Browser
Species Human (GRCh38)
Location 17:50177803-50177825
Sequence CTTTGACTAGCGGGTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791856_1148791862 0 Left 1148791856 17:50177780-50177802 CCCACGCCATAACCAAACGGGTT No data
Right 1148791862 17:50177803-50177825 CTTTGACTAGCGGGTGCCTCTGG No data
1148791857_1148791862 -1 Left 1148791857 17:50177781-50177803 CCACGCCATAACCAAACGGGTTC No data
Right 1148791862 17:50177803-50177825 CTTTGACTAGCGGGTGCCTCTGG No data
1148791858_1148791862 -6 Left 1148791858 17:50177786-50177808 CCATAACCAAACGGGTTCTTTGA No data
Right 1148791862 17:50177803-50177825 CTTTGACTAGCGGGTGCCTCTGG No data
1148791852_1148791862 27 Left 1148791852 17:50177753-50177775 CCTGTTGAATGACTAGCTCTTTA No data
Right 1148791862 17:50177803-50177825 CTTTGACTAGCGGGTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791862 Original CRISPR CTTTGACTAGCGGGTGCCTC TGG Intergenic