ID: 1148791863

View in Genome Browser
Species Human (GRCh38)
Location 17:50177814-50177836
Sequence GGGTGCCTCTGGCTTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791857_1148791863 10 Left 1148791857 17:50177781-50177803 CCACGCCATAACCAAACGGGTTC No data
Right 1148791863 17:50177814-50177836 GGGTGCCTCTGGCTTCTCCTTGG No data
1148791858_1148791863 5 Left 1148791858 17:50177786-50177808 CCATAACCAAACGGGTTCTTTGA No data
Right 1148791863 17:50177814-50177836 GGGTGCCTCTGGCTTCTCCTTGG No data
1148791856_1148791863 11 Left 1148791856 17:50177780-50177802 CCCACGCCATAACCAAACGGGTT No data
Right 1148791863 17:50177814-50177836 GGGTGCCTCTGGCTTCTCCTTGG No data
1148791859_1148791863 -1 Left 1148791859 17:50177792-50177814 CCAAACGGGTTCTTTGACTAGCG No data
Right 1148791863 17:50177814-50177836 GGGTGCCTCTGGCTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791863 Original CRISPR GGGTGCCTCTGGCTTCTCCT TGG Intergenic