ID: 1148791864

View in Genome Browser
Species Human (GRCh38)
Location 17:50177819-50177841
Sequence AATAGCCAAGGAGAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791864_1148791871 22 Left 1148791864 17:50177819-50177841 CCTCTGGCTTCTCCTTGGCTATT No data
Right 1148791871 17:50177864-50177886 CCAGGAGTTGCGCAGACCGGAGG No data
1148791864_1148791869 19 Left 1148791864 17:50177819-50177841 CCTCTGGCTTCTCCTTGGCTATT No data
Right 1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG No data
1148791864_1148791867 4 Left 1148791864 17:50177819-50177841 CCTCTGGCTTCTCCTTGGCTATT No data
Right 1148791867 17:50177846-50177868 TCTTTCTCCTGAAGGAAACCAGG No data
1148791864_1148791866 -4 Left 1148791864 17:50177819-50177841 CCTCTGGCTTCTCCTTGGCTATT No data
Right 1148791866 17:50177838-50177860 TATTTCTTTCTTTCTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791864 Original CRISPR AATAGCCAAGGAGAAGCCAG AGG (reversed) Intergenic
No off target data available for this crispr