ID: 1148791865 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:50177831-50177853 |
| Sequence | GAGAAAGAAAGAAATAGCCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148791865_1148791869 | 7 | Left | 1148791865 | 17:50177831-50177853 | CCTTGGCTATTTCTTTCTTTCTC | No data | ||
| Right | 1148791869 | 17:50177861-50177883 | AAACCAGGAGTTGCGCAGACCGG | No data | ||||
| 1148791865_1148791867 | -8 | Left | 1148791865 | 17:50177831-50177853 | CCTTGGCTATTTCTTTCTTTCTC | No data | ||
| Right | 1148791867 | 17:50177846-50177868 | TCTTTCTCCTGAAGGAAACCAGG | No data | ||||
| 1148791865_1148791871 | 10 | Left | 1148791865 | 17:50177831-50177853 | CCTTGGCTATTTCTTTCTTTCTC | No data | ||
| Right | 1148791871 | 17:50177864-50177886 | CCAGGAGTTGCGCAGACCGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148791865 | Original CRISPR | GAGAAAGAAAGAAATAGCCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||