ID: 1148791865

View in Genome Browser
Species Human (GRCh38)
Location 17:50177831-50177853
Sequence GAGAAAGAAAGAAATAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791865_1148791869 7 Left 1148791865 17:50177831-50177853 CCTTGGCTATTTCTTTCTTTCTC No data
Right 1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG No data
1148791865_1148791867 -8 Left 1148791865 17:50177831-50177853 CCTTGGCTATTTCTTTCTTTCTC No data
Right 1148791867 17:50177846-50177868 TCTTTCTCCTGAAGGAAACCAGG No data
1148791865_1148791871 10 Left 1148791865 17:50177831-50177853 CCTTGGCTATTTCTTTCTTTCTC No data
Right 1148791871 17:50177864-50177886 CCAGGAGTTGCGCAGACCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791865 Original CRISPR GAGAAAGAAAGAAATAGCCA AGG (reversed) Intergenic