ID: 1148791866

View in Genome Browser
Species Human (GRCh38)
Location 17:50177838-50177860
Sequence TATTTCTTTCTTTCTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791858_1148791866 29 Left 1148791858 17:50177786-50177808 CCATAACCAAACGGGTTCTTTGA No data
Right 1148791866 17:50177838-50177860 TATTTCTTTCTTTCTCCTGAAGG No data
1148791864_1148791866 -4 Left 1148791864 17:50177819-50177841 CCTCTGGCTTCTCCTTGGCTATT No data
Right 1148791866 17:50177838-50177860 TATTTCTTTCTTTCTCCTGAAGG No data
1148791859_1148791866 23 Left 1148791859 17:50177792-50177814 CCAAACGGGTTCTTTGACTAGCG No data
Right 1148791866 17:50177838-50177860 TATTTCTTTCTTTCTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791866 Original CRISPR TATTTCTTTCTTTCTCCTGA AGG Intergenic
No off target data available for this crispr