ID: 1148791869

View in Genome Browser
Species Human (GRCh38)
Location 17:50177861-50177883
Sequence AAACCAGGAGTTGCGCAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148791864_1148791869 19 Left 1148791864 17:50177819-50177841 CCTCTGGCTTCTCCTTGGCTATT No data
Right 1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG No data
1148791865_1148791869 7 Left 1148791865 17:50177831-50177853 CCTTGGCTATTTCTTTCTTTCTC No data
Right 1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148791869 Original CRISPR AAACCAGGAGTTGCGCAGAC CGG Intergenic
No off target data available for this crispr