ID: 1148793591

View in Genome Browser
Species Human (GRCh38)
Location 17:50186903-50186925
Sequence CAGGGTCCCCCCGGCCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 2, 2: 12, 3: 56, 4: 520}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148793591_1148793598 -1 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793598 17:50186925-50186947 GCACAGAGAGGGAAGAGAGTGGG 0: 1
1: 0
2: 4
3: 94
4: 775
1148793591_1148793602 25 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793602 17:50186951-50186973 TACCGGCATCCAAGTGCTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1148793591_1148793601 24 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793601 17:50186950-50186972 TTACCGGCATCCAAGTGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 49
1148793591_1148793605 27 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793605 17:50186953-50186975 CCGGCATCCAAGTGCTTTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 172
1148793591_1148793603 26 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793603 17:50186952-50186974 ACCGGCATCCAAGTGCTTTGGGG 0: 1
1: 0
2: 1
3: 5
4: 69
1148793591_1148793599 0 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793599 17:50186926-50186948 CACAGAGAGGGAAGAGAGTGGGG 0: 1
1: 1
2: 12
3: 131
4: 1155
1148793591_1148793597 -2 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793597 17:50186924-50186946 TGCACAGAGAGGGAAGAGAGTGG 0: 1
1: 0
2: 6
3: 80
4: 884
1148793591_1148793600 8 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793600 17:50186934-50186956 GGGAAGAGAGTGGGGATTACCGG 0: 1
1: 0
2: 2
3: 39
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148793591 Original CRISPR CAGGGTCCCCCCGGCCCTCC TGG (reversed) Exonic
900090283 1:917274-917296 CAGGGTTGCCCCAGGCCTCCTGG + Intergenic
900112433 1:1014148-1014170 CAGGGTCCCCCTTGCCAGCCAGG + Exonic
900131253 1:1088244-1088266 CAGGGTCCCCCACGCCTCCCCGG + Intronic
900252105 1:1676287-1676309 CTGGGCTCCCCCGGCCCTCCCGG + Intronic
900262515 1:1739145-1739167 CTGGGCTCCCCCGGCCCTCCCGG + Intronic
900289914 1:1919444-1919466 CAGGGTAAACCCCGCCCTCCGGG + Intergenic
900311718 1:2036588-2036610 CTGTGTCCTCCGGGCCCTCCTGG + Intergenic
900341842 1:2193353-2193375 CCGGGTCCACCTGGCCATCCTGG - Intronic
900351899 1:2238953-2238975 CCGGGTCCCCACCCCCCTCCAGG - Intronic
900369346 1:2324484-2324506 CAGGGTCTTTCCCGCCCTCCGGG - Intronic
900382576 1:2392081-2392103 CACGGTCCCCGCGGCCACCCGGG - Intronic
900428175 1:2589919-2589941 CAGGGTCCACCCACCCCACCAGG - Exonic
900516054 1:3082685-3082707 CAGGGTGCCTCCAGCCCCCCAGG - Intronic
900610665 1:3543292-3543314 CAGGGGTCCCCAGGCCCTGCGGG + Intronic
901059580 1:6465866-6465888 CTGGGGCCCCCAGACCCTCCTGG + Intronic
901323943 1:8356063-8356085 CACGGCCTCCCCGCCCCTCCTGG + Intronic
901512428 1:9724181-9724203 CAGGGGTCCCCCAGCCCTGCTGG + Intronic
901787492 1:11634401-11634423 CAGGGTCTCCCTGGCACTTCTGG - Intergenic
902039078 1:13479861-13479883 CAGGGTCCCCTCTTCTCTCCTGG + Intronic
902304040 1:15524011-15524033 CCGGGTCCCCACGCCCCTCGAGG - Intronic
902368751 1:15992875-15992897 CAGAGCCCCCTCTGCCCTCCTGG - Intergenic
902456376 1:16536507-16536529 GAGGCTCCTCTCGGCCCTCCTGG + Intergenic
902458497 1:16553678-16553700 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
902493663 1:16854238-16854260 CAGGGTGACCCTGGGCCTCCAGG - Intronic
902495787 1:16871404-16871426 GAGGCTCCTCTCGGCCCTCCTGG - Intronic
902927918 1:19709281-19709303 TAGGGTCCCCCCCCCCCGCCGGG - Intronic
903652059 1:24928677-24928699 CACGGGCCTCCCGCCCCTCCCGG + Intronic
904080996 1:27872552-27872574 CATGGTCCCCGCGGCTCTCTGGG - Exonic
904130929 1:28274573-28274595 CAGGGACCCCACTGCCCTCGTGG - Intronic
904463183 1:30692580-30692602 CAGGGTCCCCTAGCCCATCCTGG + Intergenic
904562041 1:31405508-31405530 CAGGGTCTCCCAGGACCTCTGGG - Intergenic
904619105 1:31764640-31764662 CAGGGTGTCCCGGGCCCTGCAGG + Intronic
905169025 1:36098995-36099017 GGGGGTGCCCCCGGCCCCCCCGG - Exonic
905169192 1:36099397-36099419 CGGGGTCCCCCTGGCCCCCCTGG - Exonic
905454140 1:38075956-38075978 CAGGGTCCCCTCTTCCTTCCTGG - Intergenic
905632102 1:39524640-39524662 CAGGGAACCCCAGGCCCTACGGG - Intronic
905731839 1:40303582-40303604 CCTGGTCCCCCCGGCCCTCGAGG - Exonic
905732085 1:40304354-40304376 CAGGGCCCCCCCGGAATTCCAGG - Exonic
905734345 1:40315615-40315637 CCGGGTCCCCCGGGACCGCCGGG - Exonic
906214333 1:44030383-44030405 CCGGCCCCTCCCGGCCCTCCGGG + Intronic
906276760 1:44522651-44522673 GAAGGTCCCCCCGCCCCCCCAGG - Intronic
907308290 1:53525616-53525638 CAGGCCCCACCCTGCCCTCCAGG + Intronic
907438086 1:54462263-54462285 CAGTGTCCCCTCTGCCTTCCTGG + Intergenic
908690632 1:66775610-66775632 CTGGGTCCCCACTGCCATCCTGG - Intronic
911858941 1:102921552-102921574 CAGGGGCCACCTGGTCCTCCAGG - Exonic
911860065 1:102935094-102935116 CAGGGCCCTCCCGGTCCCCCAGG - Exonic
911864273 1:102996023-102996045 CAGGGTCCCCCTGGTCCACAAGG - Exonic
911864814 1:103004624-103004646 CAAGGTCCTCCAGGTCCTCCTGG - Exonic
911864916 1:103006278-103006300 CAGGGTCCCCCTGGTCCAACGGG - Exonic
913607145 1:120476683-120476705 CAGGGTGACCCTGGGCCTCCAGG - Intergenic
913972469 1:143424817-143424839 CGCGGTGCCCCCGGCCCGCCCGG - Intergenic
914066852 1:144250430-144250452 CCCGGTGCCCCCGGCCCGCCCGG - Intergenic
914112301 1:144715924-144715946 CCCGGTGCCCCCGGCCCGCCCGG + Intergenic
914209286 1:145563462-145563484 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
914268206 1:146055830-146055852 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
914584048 1:149045155-149045177 CAGGGTGACCCTGGGCCTCCAGG + Intronic
920666090 1:207963832-207963854 CAGGGTTCCCCTGGCCCGCGCGG - Intergenic
920675285 1:208034065-208034087 CTGGGGCCCCCAGGCCCTCCGGG - Intronic
921746901 1:218750346-218750368 CAGGGTCCAACCGTCCCGCCTGG - Intergenic
922763755 1:228147324-228147346 CAGGGACACCCAGGCCCTCCCGG - Intronic
922799908 1:228360453-228360475 CTGGGTCCCCGAGGCCCTCTCGG + Intronic
924707282 1:246510851-246510873 CGGGGCCCCCTCTGCCCTCCTGG + Intergenic
1062931408 10:1354960-1354982 CAGGGGCTCCACTGCCCTCCTGG - Intronic
1063067571 10:2624515-2624537 CAGGGTCCCCTCCGAACTCCAGG + Intergenic
1063201220 10:3786067-3786089 TAGGGTCCCCTCTGTCCTCCGGG + Intergenic
1063420159 10:5906220-5906242 CAGGGTCTGCCCCGCCCTCCAGG + Exonic
1065021991 10:21508959-21508981 CGGGGTCCCCCAGGCCCGCCCGG + Intergenic
1066500663 10:35991338-35991360 CAGGGATACCCCAGCCCTCCTGG - Intergenic
1067801917 10:49365265-49365287 CAAGGGCCCTCAGGCCCTCCTGG + Exonic
1069901013 10:71706715-71706737 CAGGGCCCCCCATGCCCACCGGG - Intronic
1069942144 10:71963697-71963719 GAGGGTCTTCCCGGCCCGCCAGG - Intergenic
1070609821 10:77925950-77925972 CAGGGTCCCCGGGGGCCACCAGG - Intronic
1072465073 10:95656106-95656128 CTAGTTCCCCGCGGCCCTCCAGG - Intronic
1072499970 10:96004893-96004915 CATGGATCCCCAGGCCCTCCAGG - Intronic
1073434093 10:103505818-103505840 CAGAGTCACCCCAGCCCTCCTGG + Intronic
1073510131 10:104037719-104037741 CAGGGTCCCCCAGGCCCACCTGG - Exonic
1073510452 10:104039471-104039493 CAGGGACCACCAGGCCCACCTGG - Exonic
1073510872 10:104041502-104041524 CAAGGTCCCCCAGGCCCACCCGG - Exonic
1075087223 10:119421785-119421807 CAGGCTCACCCCTGCCCTCAGGG - Intronic
1076317201 10:129550959-129550981 CAGAGGCCCACCTGCCCTCCAGG - Intronic
1076582312 10:131520048-131520070 CAGGGTCCCCGCCCCGCTCCTGG - Intergenic
1076886215 10:133263791-133263813 ATGGGTCCCCCAGGCACTCCCGG + Intronic
1077172310 11:1172583-1172605 CAGTGCCCTCCCAGCCCTCCTGG - Intronic
1077297436 11:1832664-1832686 CGGGGTCCCTCCGGACCGCCGGG - Intronic
1077321868 11:1946448-1946470 AAGGGTCCCAGCAGCCCTCCTGG + Intergenic
1077364781 11:2157224-2157246 CAGGCTGCCCTCGGTCCTCCAGG + Intronic
1077491302 11:2862241-2862263 CAGGGTCCCAGGGGCTCTCCTGG + Intergenic
1078066784 11:8083816-8083838 CAGGATCCCCCCTGCCCTGCTGG + Intronic
1079133422 11:17762659-17762681 CAGTATCCCTCCAGCCCTCCAGG - Intronic
1080264540 11:30387763-30387785 CATGGTCCCCCCCTCTCTCCAGG + Intronic
1080397568 11:31903900-31903922 CAGGGTCACTCCTGCCCTCGTGG - Intronic
1080606529 11:33869272-33869294 CCGGGTCCCCCCGACGCTCCGGG + Intronic
1080643198 11:34169905-34169927 CAGGGTCCACCCTGGCCTCACGG + Intronic
1082807637 11:57460748-57460770 CGGGGACTCCCGGGCCCTCCCGG + Exonic
1083233235 11:61336369-61336391 CAGGTTCCCACCGGGCCACCAGG + Intronic
1083571792 11:63765145-63765167 CCTGCTGCCCCCGGCCCTCCGGG + Exonic
1083613499 11:64015404-64015426 CAGGGTCTTCCCAGTCCTCCGGG + Intronic
1084119416 11:67060133-67060155 CAGGGAGCACCCGGCCCTGCTGG + Intronic
1084191676 11:67502263-67502285 CAGGGTCCCCCCATAGCTCCAGG + Intronic
1084254668 11:67932230-67932252 CATGGTCACCCTGGCCCTGCTGG - Intergenic
1084307747 11:68297951-68297973 CTGGGTCACTCTGGCCCTCCCGG + Intergenic
1084666823 11:70580833-70580855 CAGGGTCCCCCCAGCCAAACTGG - Intronic
1084818205 11:71663657-71663679 CATGGTCACCCTGGCCCTGCTGG + Intergenic
1084973558 11:72784237-72784259 CAGAGCCCCTCCAGCCCTCCTGG - Intronic
1085315360 11:75541589-75541611 CAGGGTCCCCACACCACTCCTGG + Intergenic
1085405072 11:76256842-76256864 CAGGGTCCCACAGGCCCCACAGG + Intergenic
1085641612 11:78196513-78196535 CAGGGTGGCGCCGGCCCCCCGGG + Exonic
1086400480 11:86457373-86457395 CAGGGTCCCCAAGTACCTCCAGG + Intronic
1088735658 11:112725776-112725798 CAGGGTCCTCCCTGTCCTCAGGG + Intergenic
1088850612 11:113700336-113700358 CAGGCTCCCCTGTGCCCTCCTGG + Intronic
1089216472 11:116837388-116837410 CAGGTCCCCCACGGCCCTTCAGG - Exonic
1089560322 11:119340291-119340313 CCGGGGCACCCCGGCCTTCCAGG - Exonic
1089602886 11:119626009-119626031 CAGGGTCCCCCTGCCCTTCAGGG + Intronic
1091406354 12:211979-212001 CAGTGTCCCCCAGGCGCTGCAGG - Intronic
1091694494 12:2618602-2618624 CAGGGTTCCCCTGGCCCCTCAGG - Intronic
1092492388 12:8957040-8957062 CAGGGCCCCCCCGGCCGTGGAGG + Intronic
1092644870 12:10559453-10559475 CAGGGTCCCCCTGGGCCTCCTGG - Intergenic
1092659404 12:10722711-10722733 CAGGGTCCCCAGGGATCTCCGGG - Intronic
1094852666 12:34389230-34389252 CAGGGTCTCCCAGGGTCTCCTGG - Intergenic
1095098356 12:38159629-38159651 CAGGGACTCCGCGACCCTCCCGG - Intergenic
1095982889 12:47982873-47982895 CAGGGTCCCCGTGGCCTCCCCGG - Exonic
1095985614 12:47997625-47997647 CCTGGTCCTCCCGGCCCCCCTGG - Exonic
1096154828 12:49336197-49336219 CCAGGCCCCCCGGGCCCTCCCGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1100469046 12:94873809-94873831 CGGGGTCCCCGGGGCTCTCCCGG + Intergenic
1101733072 12:107442695-107442717 AAGAGTCCCCCTGGGCCTCCAGG - Intronic
1101874108 12:108587774-108587796 CAGGGAACGCCCAGCCCTCCTGG + Intergenic
1103480617 12:121247843-121247865 CAGGGGCCCGCCGGCCCACTGGG + Intronic
1103557761 12:121776282-121776304 CAGGATGCCCCCAGCGCTCCAGG - Exonic
1103715161 12:122940857-122940879 CAAAGTCCACCCGGCCCTCCAGG + Exonic
1104846805 12:131851080-131851102 GAGGGGCCCCGCGCCCCTCCAGG + Exonic
1104925163 12:132310223-132310245 GAGGGTGCCACCAGCCCTCCAGG + Intronic
1105202893 13:18194731-18194753 CAGGGTCCCTCCCTGCCTCCTGG + Intergenic
1106036578 13:26050338-26050360 CAGGGTCCTCCGGGCCCCTCTGG - Intronic
1108643663 13:52406216-52406238 CCGTGTGCCCCCCGCCCTCCCGG - Intronic
1110052764 13:70924357-70924379 CAGGCTGCCCACGGGCCTCCGGG + Intergenic
1111155265 13:84313359-84313381 CATTGTCCCCCCAGCACTCCAGG - Intergenic
1112509494 13:99997359-99997381 CAGGGCCGCCGCGCCCCTCCTGG - Intergenic
1113389833 13:109884874-109884896 CAGAGTCCCCACGGCCCCCCAGG + Intergenic
1113420166 13:110164963-110164985 CCGGGTCCTCCTGGCCCCCCAGG - Exonic
1113426029 13:110209399-110209421 CCAGGCCCTCCCGGCCCTCCAGG - Exonic
1113426034 13:110209408-110209430 CAGGGTCCCCCAGGCCCTCCCGG - Exonic
1113453301 13:110428545-110428567 CAGGGGCCCCCCGGCTCTGAGGG + Exonic
1113768177 13:112893896-112893918 CGGGGTCCCACCTGCCCCCCTGG - Intergenic
1113889105 13:113726658-113726680 CAAGGAGCCCCCAGCCCTCCTGG - Intronic
1114147960 14:19999826-19999848 AAGGGTCCCCCTGGCCCACATGG - Intergenic
1114265643 14:21071152-21071174 CAGGGTCCCCTAGTCCCTGCAGG - Intronic
1114538172 14:23436095-23436117 CAGTGTCCTCCCTGCTCTCCTGG + Intergenic
1118389013 14:65280824-65280846 CCTGGTCCTCCCGGCCCTCGCGG - Intergenic
1119623714 14:76152265-76152287 CATGGTCGCCCCAGCCCTCAGGG + Intronic
1122582315 14:102778098-102778120 CCGGGCCCCCCCGGCCGGCCCGG - Intronic
1122768224 14:104085665-104085687 CAGGCTGCCCCCGGCGCCCCGGG + Exonic
1122788685 14:104175445-104175467 CGGGGTGCCCACGGCCTTCCTGG - Exonic
1122825454 14:104368415-104368437 CAGGGTCTCCTGGGCTCTCCAGG + Intergenic
1122880870 14:104689906-104689928 CAGGGCGCCCCTGGCCCCCCCGG + Intronic
1122888867 14:104723629-104723651 CAGGGGCCCCGCGTCCCGCCCGG - Intergenic
1122931176 14:104933637-104933659 CAGGTCCCCTCCCGCCCTCCCGG - Exonic
1122931286 14:104933910-104933932 CAGGTCCCCTCCCGCCCTCCCGG - Exonic
1123033928 14:105464156-105464178 CGGTGTGCCCCCGGCCATCCAGG - Intronic
1202834109 14_GL000009v2_random:65161-65183 CAGAATCCCCCCCACCCTCCCGG - Intergenic
1125328543 15:38561636-38561658 CAGGGGCACCCTGGCCCTTCAGG + Intronic
1125594043 15:40873273-40873295 CGGGGCCCTCCCGGCCCCCCTGG + Exonic
1125834198 15:42736302-42736324 TCGGTTCCCCCCGGCCCTACAGG - Exonic
1126021733 15:44408819-44408841 CAGGCTCCCGCCGCCACTCCGGG - Intronic
1126098929 15:45108132-45108154 CAGGGTCCCCATGGCTCTCCAGG + Exonic
1126104858 15:45140963-45140985 CAGGGTCCCGGTGGCTCTCCAGG - Exonic
1126704867 15:51397502-51397524 CCTGGGCCCCCAGGCCCTCCAGG + Exonic
1127257762 15:57306462-57306484 GAGGGTCCCCCCGGGCCACTTGG - Intergenic
1127453880 15:59140785-59140807 CAGGGGCGCCCAGCCCCTCCTGG - Intronic
1128534643 15:68481432-68481454 CTGGGTCCCCCCAGCCACCCTGG + Intergenic
1129227443 15:74178375-74178397 CGTGGTCCCCACTGCCCTCCAGG + Intergenic
1129298161 15:74611072-74611094 CAGGGTCCCTGTGGCCCCCCAGG - Intronic
1130275143 15:82472548-82472570 CAAGCTCCCCCCGTCACTCCAGG - Intergenic
1130467491 15:84199916-84199938 CAAGCTCCCCCCGTCACTCCAGG - Intergenic
1130496769 15:84473619-84473641 CAAGCTCCCCCCGTCACTCCAGG + Intergenic
1130580575 15:85134085-85134107 CAGGGGCCCCCGTTCCCTCCTGG - Intronic
1130589789 15:85204520-85204542 CAAGCTCCCCCCGTCACTCCAGG - Intergenic
1131078411 15:89513758-89513780 CAGGGTCCCTCTGTCCCTACTGG + Intergenic
1132623644 16:879843-879865 CAGGATCCCCCCGGCCCGCCTGG + Intronic
1132757844 16:1494554-1494576 CTTGGTCCGCCGGGCCCTCCAGG - Exonic
1132761142 16:1509170-1509192 CAGGGCCCCCCTGCTCCTCCTGG - Intronic
1132907086 16:2288203-2288225 CTGCGTCACCCTGGCCCTCCTGG - Exonic
1135733503 16:24913313-24913335 AAGGGCACCCCCAGCCCTCCTGG + Intergenic
1136014043 16:27383597-27383619 CAGCCTCCCCCCAGCCCTCCAGG + Intergenic
1136058095 16:27705816-27705838 CAGGGGCCCCCCAGCACACCTGG + Intronic
1136578954 16:31140609-31140631 CAGGCCCCCCCTGGCCCTCCTGG - Exonic
1136707776 16:32202916-32202938 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1136760133 16:32726495-32726517 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1136807971 16:33143891-33143913 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1138565986 16:57833236-57833258 CACTGTCCCCTCTGCCCTCCTGG - Intronic
1138590748 16:57998481-57998503 CAGAGTCTCCCCGGCACTGCTGG - Exonic
1139691113 16:68642750-68642772 CAGGTTCCCCCGCGCCCGCCCGG - Intronic
1139691654 16:68645545-68645567 CAGGGTCCTCACGGGCCTTCCGG - Intronic
1141399328 16:83733357-83733379 CAGGGACCCTGCAGCCCTCCCGG + Intronic
1141608958 16:85170574-85170596 CCGTGTCCCCCGGGCTCTCCAGG + Intergenic
1141684271 16:85561552-85561574 AAGGCTGCCCTCGGCCCTCCAGG + Intergenic
1141733246 16:85836092-85836114 CAGGCTCCCCCTGGCCTTTCTGG + Intergenic
1141957633 16:87383359-87383381 CAGGGACCCCCCGCCCCTCCCGG + Intronic
1203062289 16_KI270728v1_random:986817-986839 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1142888517 17:2928380-2928402 GAGGGTGCCCCTGGTCCTCCTGG - Intronic
1143011654 17:3869434-3869456 TCAGGTCCCCCAGGCCCTCCAGG + Intronic
1143034329 17:3985853-3985875 CAGGGCCCCCTCGGGCCCCCTGG + Intergenic
1143102819 17:4513682-4513704 CAGGGTCACCACGGCTCTGCTGG - Intronic
1143111503 17:4555434-4555456 CTTGGTTCCCCCGCCCCTCCGGG - Intronic
1144728261 17:17512480-17512502 CAGGGTCACCCCAGCCCTCAGGG + Intronic
1144728694 17:17514620-17514642 CAGGGTCACCCCGCAGCTCCAGG + Intronic
1145064106 17:19750293-19750315 CAGGATGCCCTCGGCCCGCCAGG - Intergenic
1145191554 17:20844349-20844371 CGGGGTCCCCCGGGCCGCCCGGG - Intronic
1145200153 17:20937871-20937893 CAGGGTCCCCTCGCACCTCGGGG - Intergenic
1146183220 17:30709921-30709943 CAGCGTCCCCTCCGCCCTCGCGG - Intergenic
1146275001 17:31510809-31510831 CAGGGTACCTCCTGGCCTCCTGG - Intronic
1146955076 17:36932683-36932705 CAGGGTCCCTCCAGCGCTCGTGG + Intergenic
1147400542 17:40177961-40177983 CCGGGTCCCCCACCCCCTCCAGG - Intronic
1147441906 17:40452679-40452701 GAGGGTCCCCTGGGCCCTGCAGG - Intronic
1147559990 17:41502874-41502896 CTGTGTCCGCCCGGCCCCCCTGG + Intronic
1147605841 17:41773299-41773321 CAGTGCCGCCCTGGCCCTCCAGG + Intronic
1148106461 17:45121372-45121394 CCGGGTCCTCCCGCCCCGCCAGG - Exonic
1148747533 17:49927058-49927080 CAGGGTCCTCCCACCCCTGCTGG + Intergenic
1148752518 17:49953472-49953494 CAGAGTCTCCCAGGCCCACCTGG + Intergenic
1148793591 17:50186903-50186925 CAGGGTCCCCCCGGCCCTCCTGG - Exonic
1148793643 17:50187103-50187125 CAGGGTCCCCCTGGCTCTGCTGG - Exonic
1148794207 17:50189411-50189433 CCTGGTCCCCCTGGCCCTGCTGG - Exonic
1148794449 17:50190343-50190365 CCTGGTCCCCCCGGCCCTGCTGG - Exonic
1148794809 17:50191831-50191853 CAAGGTCCCCCTGGTCCTGCTGG - Exonic
1148794950 17:50192509-50192531 CAGGGTCTCCCTGGTCCTGCTGG - Exonic
1148795475 17:50194791-50194813 CAAGGACCCCCTGGCCCTGCTGG - Exonic
1148795596 17:50195248-50195270 CAGGGCCCCGGCGGCCCTCCTGG - Exonic
1148795767 17:50195957-50195979 CAGGGTCCCACCGGCCCCGCTGG - Exonic
1148796356 17:50199245-50199267 CCCGGACCCCCCGGACCTCCCGG - Exonic
1148796380 17:50199308-50199330 CAGGGACCCGCAGGCCCCCCTGG - Exonic
1148852214 17:50560870-50560892 CACTGTCTCCCCGCCCCTCCCGG + Intergenic
1148855305 17:50575938-50575960 CAGGGCCCCCCGGGCCAGCCCGG + Exonic
1150827532 17:68490199-68490221 CAGGGTCCCTTTGGCCCTCTGGG + Intergenic
1151618271 17:75228968-75228990 CAGGGTCCCTTCTTCCCTCCTGG + Intronic
1152334637 17:79693470-79693492 CAGGCTCCCCTGTGCCCTCCCGG - Intergenic
1152386966 17:79980503-79980525 CAGGGTCCTCCAGGGCCTGCGGG - Intronic
1152477691 17:80528755-80528777 GAGGGGCTCCCCGGTCCTCCCGG + Intergenic
1152606787 17:81295386-81295408 CAGTTTCCGCCCGCCCCTCCGGG - Intronic
1152920233 17:83062859-83062881 CAGGGTACCCCAGGCCCTGGCGG - Intergenic
1152987638 18:334807-334829 AAGGGCCCCCCCGGCCCTCCTGG - Exonic
1152987683 18:334933-334955 GAGGGACTCCCCGGCCCTCAGGG - Exonic
1152987767 18:335167-335189 CAGGGACCCCCTGGCCCAACTGG - Exonic
1153815078 18:8784444-8784466 CAGAGTCCTCCCGGGCCTTCAGG - Exonic
1155963947 18:32018926-32018948 CCGGGTCCCTCCTGCGCTCCAGG - Exonic
1156458333 18:37307155-37307177 CAGGGTGCTCCCCGCCCACCTGG + Intronic
1159118522 18:64142567-64142589 CAGGGACCCCCAGGCACTGCTGG + Intergenic
1160397499 18:78583258-78583280 CAGGATCCTCCCAGGCCTCCTGG + Intergenic
1160501252 18:79402001-79402023 CTGGGTCTCCCCGGCCTCCCAGG + Intronic
1160594649 18:79964997-79965019 CAGGGTCCCCCAGGTCTTCAGGG - Intronic
1160677120 19:397404-397426 CAGAGGCCCCTCGTCCCTCCTGG + Intergenic
1161001974 19:1915121-1915143 CAGTGTCCTCCTGGCCCACCTGG + Intronic
1161298883 19:3533272-3533294 CAGCGCCCCCTCCGCCCTCCAGG + Exonic
1161322074 19:3645936-3645958 CAGGGTCCCTCCCGCCTTGCGGG + Intronic
1161376397 19:3941208-3941230 CAGGGTCCCCCCCGCCCGCCCGG - Intronic
1161377476 19:3947348-3947370 CAGGGTCCCGCCAGTCCCCCAGG + Intergenic
1161405402 19:4088581-4088603 CACATTCCCCCCGGCCCTCCCGG + Intergenic
1161445131 19:4314071-4314093 CAGCCTCTCCCCGCCCCTCCGGG - Intronic
1162104952 19:8364597-8364619 CAGGGTCCACCCGGCTCTCAGGG - Exonic
1162315596 19:9936449-9936471 CAGGGTCGCCCCGGCCGGGCGGG - Exonic
1162321607 19:9973953-9973975 CAGGGTCCCCATGGAGCTCCAGG - Exonic
1162321670 19:9974205-9974227 CAGGGGCTGCCAGGCCCTCCGGG - Exonic
1162325364 19:9996100-9996122 AAGGGTCTCCCCGGGCATCCAGG - Exonic
1162341406 19:10093505-10093527 CACGGCCCCCCCAGTCCTCCAGG + Exonic
1162514210 19:11138505-11138527 CAGGCTGCCCCCAGCCCTGCAGG - Intronic
1162716989 19:12640439-12640461 GAGGGTGCCCCGGGCCCACCAGG - Intergenic
1163314930 19:16535331-16535353 CAGGGCCCCCCCTGCCACCCAGG - Intronic
1163804222 19:19386278-19386300 CTGGGCCCCCCCGCCTCTCCAGG + Intronic
1165758511 19:38307733-38307755 CAGGTTCTCCCCAGACCTCCTGG - Exonic
1165900117 19:39165575-39165597 CAGTGTCACCTCAGCCCTCCAGG + Intronic
1166001358 19:39879501-39879523 CAGGATCCCTCCTGCCCTCCCGG + Intronic
1166004141 19:39895752-39895774 CAGGATCCCTCCTGCCCTCCCGG + Intronic
1166136998 19:40783756-40783778 CTGGGTCCCCCTGGCCCCACAGG + Exonic
1166379472 19:42348365-42348387 CCTGGTCCACCTGGCCCTCCAGG - Exonic
1166731847 19:45063859-45063881 CTGGGTCTCCACTGCCCTCCAGG + Intronic
1166995117 19:46716417-46716439 CAGGGTCCCCCGGGGCCCCCCGG - Exonic
1166996790 19:46723240-46723262 CGGCGTCCCCGTGGCCCTCCAGG + Exonic
1167043999 19:47039466-47039488 CACGTTGCCCCCGGCCCCCCTGG + Exonic
1167483444 19:49746602-49746624 CAGGGCTGCCCCGGCCCGCCAGG - Exonic
1167578648 19:50329524-50329546 CATGGTGGCCCCGCCCCTCCAGG - Intronic
1167609846 19:50501777-50501799 CAGCCTCCTCCCGGGCCTCCTGG + Intergenic
1168316412 19:55486606-55486628 CAGGGGCCCCCCAGGCCACCCGG - Exonic
1168702883 19:58451991-58452013 CAGGGACTCCCCCGCCCCCCCGG - Intronic
1202638572 1_KI270706v1_random:62531-62553 CAGAATCCCCCCCACCCTCCCGG + Intergenic
1202707270 1_KI270713v1_random:32863-32885 GAGGCTCCTCTCGGCCCTCCTGG + Intergenic
1202709034 1_KI270714v1_random:6428-6450 CAGGGTGACCCTGGGCCTCCAGG - Intergenic
925088990 2:1138163-1138185 CAGGGTCTCCCCGTACCGCCCGG + Intronic
925211863 2:2056258-2056280 CTGGGTCCCTCAGGCTCTCCAGG + Intronic
925270312 2:2601407-2601429 CAGCATTCCCCAGGCCCTCCAGG - Intergenic
926027353 2:9556301-9556323 CACGGACCCCCCGCCCCCCCCGG + Intergenic
927168771 2:20350955-20350977 CAGGGCGCCCCCGGCCCGCGCGG - Intronic
927192311 2:20525051-20525073 CAGTGACCTCCCGGGCCTCCTGG - Intergenic
927192344 2:20525258-20525280 CAGTGTCCCCGCTGCCCTTCTGG + Intergenic
927200352 2:20574552-20574574 CAGTGATCCCCTGGCCCTCCAGG - Intronic
927702614 2:25277442-25277464 CAGGGTCCGCCGGGACCGCCAGG - Intronic
927892893 2:26763607-26763629 CAGGGTCCCCAAGGAACTCCCGG + Intergenic
927937622 2:27084456-27084478 CAGGGACCCCCAGGCCCTGCTGG + Exonic
928898800 2:36295726-36295748 AAGGGTCCCCTCTGCCTTCCTGG - Intergenic
931695215 2:64865827-64865849 AGGGGTCTCCCTGGCCCTCCCGG - Intergenic
932180710 2:69643718-69643740 CAGTCTCCGCCCGGCGCTCCCGG - Intronic
932347897 2:71007506-71007528 CAGGGTCCCCTCAGGCCTCTGGG + Intergenic
932411650 2:71551229-71551251 CAGGGTCTTCCAGCCCCTCCTGG + Intronic
934678556 2:96266418-96266440 CAGGGTCCCCGCGGGGTTCCAGG - Exonic
934717047 2:96550348-96550370 CAGAGTCCACCCGGCCCTCCCGG - Intronic
934993391 2:98936522-98936544 CCGGTGCCCCCCGGCCCTCCCGG - Intergenic
935217878 2:100988878-100988900 CAGGCGCCCCCTGCCCCTCCAGG + Intronic
936284853 2:111174005-111174027 CAGGCTCGCCCCTGACCTCCTGG + Intergenic
937061282 2:118982170-118982192 CAGGGTGTTCCGGGCCCTCCTGG + Exonic
937259639 2:120577173-120577195 CAGGGACCCCCGGGACCCCCAGG + Intergenic
937999202 2:127719371-127719393 CAAGGACCCCCCGGACCTCAGGG - Exonic
937999353 2:127719881-127719903 CAGGGTCCACCTGGCCCACAGGG - Exonic
938070308 2:128304949-128304971 CATGGTCCCCAGGGCCTTCCTGG + Intronic
938310544 2:130285969-130285991 CAGGGTCTTCCTGGCCCTCAGGG + Intergenic
938444382 2:131366398-131366420 CAGGGTCTTCCTGGCCCTCAGGG - Intergenic
938727525 2:134120868-134120890 CGGGGCGCCCCCGGGCCTCCTGG - Intronic
943523594 2:188988078-188988100 CAGGGCCCCCCAGGCCCTCCCGG + Exonic
943523684 2:188989393-188989415 CAGGGCCCTCCAGGACCTCCTGG + Exonic
943523901 2:188992884-188992906 CAGGGCCCTCCTGGTCCTCCTGG + Exonic
943528229 2:189045843-189045865 CAGGGTGCCCCTGGAACTCCTGG - Exonic
946392319 2:219423895-219423917 CAGGGTCCCATCCTCCCTCCTGG - Intronic
947142256 2:227030496-227030518 CCAGGTCCCCCTGGCCCACCAGG - Exonic
947144341 2:227051029-227051051 CCTGGACCCCCAGGCCCTCCAGG - Exonic
947144972 2:227055998-227056020 CATGGTCCCCCAGGCCTCCCAGG - Exonic
947148348 2:227088759-227088781 ATGGGCCCCCCTGGCCCTCCAGG - Exonic
947151321 2:227118742-227118764 CAGGGGCACCCAGGGCCTCCTGG - Exonic
947151524 2:227121129-227121151 CAGGGTCCACCAGGACCACCAGG - Exonic
947169670 2:227298687-227298709 CCTGGTCCCCCTGGACCTCCAGG + Exonic
947947662 2:234120436-234120458 CTGGGTCCCCCAGGCCACCCCGG + Intergenic
948598888 2:239096996-239097018 CAGGGGCTCCCAGGCCCCCCAGG + Intronic
948844520 2:240676764-240676786 CAGGAGCCCCGCGGCCCACCTGG - Intronic
948849340 2:240698115-240698137 CAGGAGCCCCGCGGCCCACCTGG + Intronic
948857583 2:240737201-240737223 CAGGGTCCCACCTGCCCCCTGGG - Intronic
948886757 2:240888660-240888682 CAGGGTCAGCCCTGGCCTCCTGG + Intronic
1169195919 20:3681969-3681991 CGGGGTCCCCCGAGCTCTCCGGG + Exonic
1170151471 20:13231305-13231327 CAGGCTACCCCATGCCCTCCCGG + Intronic
1170572619 20:17641049-17641071 GAGGGGCCCCCTGGCCCTCTGGG - Intronic
1171473427 20:25390199-25390221 AAGGGTCCCCCCGGCTTCCCCGG + Intronic
1171972523 20:31573151-31573173 CGGGGGCCCCCCTGCCCGCCTGG - Intronic
1173179490 20:40793772-40793794 CAGGGTCTCCCCTGTCATCCAGG + Intergenic
1173279655 20:41617769-41617791 CAGGGGCCCCCGCCCCCTCCCGG + Intronic
1174461843 20:50688864-50688886 CAGGGTCCCCCAGTTCATCCTGG - Intronic
1174917142 20:54665275-54665297 CATGGACCCCACTGCCCTCCAGG - Intergenic
1175133591 20:56807190-56807212 CAGGGAGCCCCAGGCCCACCAGG + Intergenic
1175466775 20:59194674-59194696 GAGGGTCCCAATGGCCCTCCTGG + Exonic
1175790104 20:61735550-61735572 CAGGGTCCCTGTGGCCCCCCAGG - Intronic
1175874908 20:62224748-62224770 AAGCGTCCCCCAGGCCCTCCTGG - Intergenic
1175997322 20:62817579-62817601 CCCGGCCCCCCCGGCCCCCCAGG + Exonic
1175998613 20:62822135-62822157 CCTGGTCCCCCAGGACCTCCCGG + Exonic
1175999546 20:62825814-62825836 CAGGGTGACCCTGGCCCCCCTGG + Exonic
1176001961 20:62836250-62836272 CAGGGTGTCCCCGGGCCCCCCGG + Exonic
1176101318 20:63365763-63365785 CAGAGTGCACCCGGCCCTGCGGG + Intronic
1176199555 20:63854294-63854316 CAGCGTCCCCTCTGCACTCCAGG - Intergenic
1176220446 20:63967075-63967097 CAGAGCCCCCCCGGGCCTGCAGG + Intronic
1176258473 20:64166363-64166385 CAGGGTCCCCCCGACCCCCTGGG + Intronic
1176296670 21:5076750-5076772 CTGTGTCCCCCGTGCCCTCCGGG - Intergenic
1176604206 21:8815670-8815692 CGCGGTGCCCCCGGCCCGCCTGG - Intergenic
1178843691 21:36157167-36157189 CAGTCTCCCCGCTGCCCTCCCGG - Intronic
1179176626 21:39012261-39012283 CAGGGTCCCTCTGACCCACCTGG - Intergenic
1179332305 21:40415736-40415758 GAGGGTCCCACCGGCCCCCTGGG - Intronic
1179520344 21:41939604-41939626 CAGGGCCCTCCCAGCTCTCCAGG + Intronic
1179631800 21:42683537-42683559 AAGGATCCCCCCAGGCCTCCGGG + Intronic
1179635155 21:42704036-42704058 CAGGCTCCCGCCAGCCCTCACGG + Intronic
1179860379 21:44185371-44185393 CTGTGTCCCCCGTGCCCTCCGGG + Intergenic
1179991086 21:44948581-44948603 CAGGGGCCCCCAGCCCCACCCGG - Intronic
1180009421 21:45040031-45040053 CAGGGACCCCCCAGGCCCCCAGG - Intergenic
1180079025 21:45477909-45477931 CAAGGACCCCCAGGGCCTCCGGG + Exonic
1180079639 21:45480829-45480851 GAGGGTCCCCCCGGGTTTCCTGG + Exonic
1180079905 21:45481960-45481982 CAGGGACCCCCAGGCCCTCCGGG + Exonic
1180081166 21:45488415-45488437 CAGGGACCTCCCGGCCTGCCGGG + Exonic
1180083292 21:45496524-45496546 CCAGGGCCCCCAGGCCCTCCAGG + Exonic
1180084988 21:45504500-45504522 CCCGGCCCCCCCGGCCCCCCAGG + Exonic
1180085207 21:45505215-45505237 CAGGGCCCTCCCGGCCCCCCAGG + Exonic
1180182675 21:46124882-46124904 CAGGGTGAGCCCGGCCCCCCTGG + Exonic
1180185852 21:46138852-46138874 CACGGTGCGGCCGGCCCTCCAGG + Intronic
1180346497 22:11707277-11707299 CGCGGTGCCCCCGGCCCGCCTGG - Intergenic
1180354260 22:11825401-11825423 CGCGGTGCCCCCGGCCCGCCTGG - Intergenic
1180363394 22:11919357-11919379 CAGAATCCCCCCCACCCTCCCGG - Intergenic
1180383995 22:12166954-12166976 CGCGGTGCCCCCGGCCCGCCTGG + Intergenic
1180729600 22:17971770-17971792 AAGGGGCCCCCTGGCCCTTCAGG + Intronic
1180954468 22:19735484-19735506 CAGTGTCCTCCTGGGCCTCCTGG + Intergenic
1181018483 22:20085153-20085175 CAGGGACCCCAGGGCTCTCCTGG - Intronic
1181091110 22:20473188-20473210 CAGGGTCACCCTTGGCCTCCAGG - Intronic
1181120742 22:20667708-20667730 CAGGGTCCCCTAGGCCGCCCGGG + Intergenic
1181333707 22:22114735-22114757 CAGGGTCCCCTAGGCCGCCCGGG + Intergenic
1181419760 22:22789614-22789636 CTGAGTCCCTCCAGCCCTCCAGG + Intronic
1182284009 22:29233429-29233451 CAGGGACCCACTGGGCCTCCAGG + Exonic
1182284055 22:29233610-29233632 CCAGGTCCCCCTGGGCCTCCTGG + Exonic
1182284137 22:29234134-29234156 CAGGGACCCCCAGGCCCCACTGG + Exonic
1182293324 22:29298744-29298766 ATGGGTCCCCCAGGACCTCCTGG - Exonic
1183063879 22:35350753-35350775 CAGGGTCCCCCTGGCGTTCCTGG + Intergenic
1183285421 22:36959578-36959600 CAGGGTCCCCAGGGCGCCCCAGG - Intergenic
1184168372 22:42743805-42743827 CAGGGCCCCACCCGGCCTCCAGG - Intergenic
1184189543 22:42885711-42885733 CAGGTTCCACCCCGCCCTCTAGG + Intronic
1184648087 22:45906982-45907004 CAGGGTCCCGCCAGCCCCTCAGG + Intergenic
1184712835 22:46263175-46263197 CAGGGGCGCCCCGGGCCTCGGGG - Exonic
1185038022 22:48489772-48489794 CAGGCGCCCCGCGGGCCTCCCGG + Intronic
1185093130 22:48786900-48786922 CAGGCTCAGCCCTGCCCTCCAGG - Intronic
1185275245 22:49947860-49947882 CAGGCTCCCTCCTGTCCTCCGGG + Intergenic
950448556 3:13052679-13052701 CAGTTTCCCCACAGCCCTCCTGG + Intronic
950751863 3:15135491-15135513 CATGGTCACCCTGGCCCTGCTGG + Intergenic
952497531 3:33928940-33928962 GAGGGTCCCCCAGGCTGTCCAGG + Intergenic
953771247 3:45779990-45780012 CACGGGCCCCCCGGCTCACCTGG + Exonic
954110032 3:48428806-48428828 GAGGGTCCCCCCCACCCGCCCGG + Intronic
954133879 3:48573181-48573203 CCTGGACCCCCCGGCCCTTCAGG - Exonic
954135416 3:48580038-48580060 CAGGGTCCCCCAGGACCCCCGGG - Exonic
954136480 3:48584356-48584378 CAGGGCCCCCCTGGACCTCGTGG - Exonic
954329948 3:49884535-49884557 CATGGTCCCCCAGCCCATCCAGG + Intergenic
954333506 3:49903263-49903285 CCAGGACCCCACGGCCCTCCCGG - Exonic
954615660 3:51967649-51967671 AAGGGTCGCCCGAGCCCTCCAGG - Intronic
955412325 3:58663815-58663837 CAGCCTCTCCCCGGCCCTGCTGG + Intronic
957068750 3:75548813-75548835 CATGGTCACCCTGGCCCTGCTGG - Intergenic
958892408 3:99795576-99795598 CCAGGACCCCCAGGCCCTCCAGG + Exonic
961037991 3:123656213-123656235 CAGACTCCCCCAGGCCCTTCTGG - Intronic
961628008 3:128276896-128276918 CAGCGTCTCCCCTTCCCTCCTGG - Intronic
963827590 3:149971241-149971263 CAGTCTCCCCCCGCCCTTCCCGG - Intronic
966465643 3:180228293-180228315 CTGGGTCCCCCCGGCTGTCTTGG - Intergenic
966861508 3:184233360-184233382 CCGGGGCCCCCCAGGCCTCCGGG + Exonic
967108309 3:186271409-186271431 GAGGGTCCCCCAGGCCATGCTGG - Intronic
968151256 3:196338389-196338411 CAGAGCCTCCCTGGCCCTCCTGG - Intronic
968441168 4:625221-625243 CAGGTGGCCCCAGGCCCTCCTGG - Intergenic
968547885 4:1207924-1207946 CCGGGCCACCCCGTCCCTCCTGG + Intronic
968702421 4:2063251-2063273 CAGGGTCACCCGGGCCATCACGG - Intronic
968978927 4:3836365-3836387 CTGGGTGCCCCCAGCCCTCCAGG + Intergenic
969013078 4:4083350-4083372 CATGGTCACCCTGGCCCTGCCGG - Intergenic
969251467 4:5971163-5971185 CAGAGTCTCCCCAGCCATCCTGG + Intronic
969740765 4:9024440-9024462 CATGGTCACCCTGGCCCTGCTGG + Intergenic
973373912 4:49275279-49275301 CGCGGTGCCCCCGGCCCGCCTGG + Intergenic
973383500 4:49334960-49334982 CGCGGTGCCCCCGGCCCGCCTGG - Intergenic
973387105 4:49519974-49519996 CGCGGTGCCCCCGGCCCGCCTGG - Intergenic
974028591 4:56755883-56755905 CGGGGTTCCTCAGGCCCTCCTGG - Intergenic
975683520 4:76898012-76898034 GAGGGGACCCACGGCCCTCCTGG - Exonic
978452649 4:108852261-108852283 TAGGGTCCCCCTGGACCTCCTGG - Exonic
978459965 4:108940600-108940622 CCAGGACCCCCTGGCCCTCCAGG - Exonic
980988558 4:139718606-139718628 CAGGGTCCATCCGGCAGTCCTGG - Exonic
984857293 4:184205980-184206002 CAGTGTCCTCCCGGGCGTCCTGG - Intronic
1202765911 4_GL000008v2_random:148390-148412 CAGAATCCCCCCCACCCTCCCGG + Intergenic
985548804 5:523114-523136 CAGGGTCTCCCCTCCCCTTCAGG - Intronic
985616666 5:927010-927032 CAGGCTCGCCCGGTCCCTCCTGG - Intergenic
985658718 5:1145063-1145085 CAGGCTCTCTCCAGCCCTCCAGG - Intergenic
985729887 5:1541181-1541203 GAGGGTCCTCCCTGCCCCCCAGG + Intergenic
985769381 5:1799475-1799497 CAGTGTCCTCCGGGCCCTGCAGG - Intronic
985777522 5:1852539-1852561 CAGGTTCCCCTCGCCCCTCATGG + Intergenic
986292510 5:6411437-6411459 CAGGGTCCAGCTGACCCTCCTGG - Intergenic
995213487 5:109568168-109568190 CAGGGTCTCTCAGGCCCTCTTGG + Intergenic
997438744 5:133893646-133893668 CAGGGTTCCCTTGGCCCTCTGGG - Intergenic
998399415 5:141840743-141840765 CAGGGTAGACCCAGCCCTCCAGG + Intergenic
998850483 5:146346159-146346181 CAGGGTTCGCCCGCTCCTCCCGG + Intergenic
999432885 5:151539041-151539063 CAGGCTCACCCTGGCCCTCCCGG - Intronic
1000351289 5:160354866-160354888 CAGGGCCCACCCGGCCCCCCAGG - Exonic
1001922055 5:175608545-175608567 CAGGGTCCCGGAGGCCCTTCTGG - Intergenic
1001961459 5:175882510-175882532 TGGGGTCCCTCCGGCCCACCTGG - Exonic
1002299991 5:178252560-178252582 CAGGGGCCCCCAGGGCCACCAGG - Exonic
1002302158 5:178263269-178263291 CCGGGGCCCCCTGGACCTCCTGG - Exonic
1002714681 5:181219569-181219591 CAAGGTCACCACGGGCCTCCAGG + Intergenic
1002879397 6:1238082-1238104 CGGGGTCTCCCTGGCCCCCCAGG - Intergenic
1004970787 6:20907797-20907819 CATGCTCCCCAAGGCCCTCCAGG - Intronic
1006058535 6:31403301-31403323 CAGGGCCCTGCCTGCCCTCCCGG - Intronic
1006136698 6:31900373-31900395 CAGGCTGCCCCCCGCCCCCCGGG + Exonic
1006295989 6:33170360-33170382 CAGGGACCACCTGGCCCCCCAGG - Exonic
1006297505 6:33176467-33176489 CAGGGTCCCTCTGGACCTCAGGG - Exonic
1006297661 6:33177188-33177210 CAGGGTGCCATCGGCCCTCATGG - Exonic
1006298131 6:33179089-33179111 CAGGGCCTCACAGGCCCTCCTGG - Exonic
1006304569 6:33211432-33211454 CTGGGCCCCCCAAGCCCTCCTGG + Exonic
1007776926 6:44229110-44229132 CAGAGTCCCCCGAGCCTTCCAGG + Intronic
1009561102 6:65244653-65244675 CAGGCGCCCGCCAGCCCTCCCGG + Intronic
1009935749 6:70232672-70232694 CCTGGTCCCCCCGGCCCTCCTGG - Exonic
1009935953 6:70234810-70234832 CAGGGTGCCACCGGCCTGCCTGG - Exonic
1009940193 6:70281424-70281446 CAGGGTCCTCCCGGGCCTCCGGG - Exonic
1010369460 6:75090199-75090221 CCGGGTCCACCGGGACCTCCTGG - Exonic
1010370592 6:75102628-75102650 CAGGGTCCTCCAGGCCCTCAGGG - Exonic
1012276364 6:97279642-97279664 CAGGGTCCCCCCACCACGCCCGG - Intronic
1012400132 6:98835609-98835631 CAGGGTCCGCCTGGCCACCCAGG + Exonic
1013980361 6:116121349-116121371 CCAGGTCCCCAAGGCCCTCCTGG - Exonic
1015181294 6:130365470-130365492 CAGGGGGACCCCGGCCCGCCGGG + Intergenic
1015502894 6:133952284-133952306 CGGGGTCCCCCGGCCCCTGCAGG + Intronic
1015939472 6:138433302-138433324 CTGGGTGCCCTCGGCCCTGCAGG - Exonic
1018032310 6:159851173-159851195 CTGGGTCCCCTTGGCCCTGCAGG - Intergenic
1018109399 6:160520460-160520482 CCGGGTCCCCCCAGCACTGCCGG - Intergenic
1018673059 6:166195350-166195372 CAGGTGCCCCGCGGCCCTGCAGG + Intergenic
1018818016 6:167350507-167350529 CAGGGTCCCCCGGCTCCCCCGGG - Intronic
1018828544 6:167424512-167424534 TTGGGTCCACCAGGCCCTCCCGG + Intergenic
1018839286 6:167507143-167507165 CAGGGTCCCGCAGAGCCTCCCGG + Intergenic
1018892078 6:167989725-167989747 CCAGGTCCTCCTGGCCCTCCCGG + Intergenic
1019332016 7:464886-464908 CAGCCTCCCCCAGGCCCCCCAGG - Intergenic
1019434615 7:1015601-1015623 CTGGGTCCTCCCTGCCCTCTGGG - Intronic
1019434625 7:1015631-1015653 CTGGGTCCTCCCTGCTCTCCTGG - Intronic
1019494197 7:1329975-1329997 CAGGGACATCCCTGCCCTCCTGG + Intergenic
1019505136 7:1386787-1386809 CAGGGCCCAGCCAGCCCTCCTGG + Intergenic
1019557522 7:1640065-1640087 GAGCTTCCCCCCGGCCCTGCTGG - Intergenic
1019624720 7:2010207-2010229 CAGGCTCTCCCCAGCCCTCCTGG + Intronic
1019645083 7:2124691-2124713 CAGGGTGGGCCTGGCCCTCCCGG - Intronic
1019989494 7:4682064-4682086 CGGGGGCCCGCCGGCCCTCCCGG + Intergenic
1020560624 7:9726468-9726490 CAAGGTGCCCACGGGCCTCCGGG + Intergenic
1021411277 7:20331597-20331619 CAGGGCCCCTGCGGCCCTCCCGG - Exonic
1021828010 7:24573643-24573665 CAGGGCGCCCCCGGCCGGCCCGG - Intronic
1023810292 7:43906426-43906448 CAGGGGCGCCCCCGCCCGCCAGG - Intronic
1023845020 7:44115707-44115729 CAGGGTCCTGCCAGGCCTCCTGG + Intronic
1024042360 7:45565277-45565299 CAGGACCCACCCTGCCCTCCAGG - Intergenic
1024418147 7:49132247-49132269 CTGGGTCCCCTCAGTCCTCCAGG - Intergenic
1025017176 7:55449183-55449205 CAGGGGACCCGCGGCGCTCCGGG - Intronic
1025819172 7:64947057-64947079 CAAGCCCCCCCAGGCCCTCCAGG - Intergenic
1025940960 7:66075978-66076000 CAGGGTCCCCCGGGCCGGGCTGG - Intronic
1026881253 7:73908155-73908177 CTGGCTCCCCACTGCCCTCCAGG + Intergenic
1027189247 7:75988233-75988255 CAGGGCCCGCCCTGCCCACCGGG + Exonic
1028752763 7:94400193-94400215 CAGGGTCCACCAGGCCCCCCAGG + Exonic
1028752774 7:94400229-94400251 GATGGTCCCACAGGCCCTCCTGG + Exonic
1028753998 7:94413918-94413940 CAGGGTCCCCCTGGTCCTCCAGG + Exonic
1028754613 7:94421015-94421037 AATGGTCCCCCCGGTCCTGCTGG + Exonic
1028755365 7:94427624-94427646 CAGGGCCCCCCTGGTCCCCCTGG + Exonic
1028755371 7:94427633-94427655 CCTGGTCCCCCTGGCCCTCCTGG + Exonic
1029434517 7:100555068-100555090 CAGGGGCACCCAGGGCCTCCAGG - Intronic
1029467802 7:100737058-100737080 CAGGGTTCACCCTGCCCACCCGG + Exonic
1029597877 7:101547218-101547240 CGGGGTCCCCCTGGTCCACCAGG + Exonic
1032017090 7:128387262-128387284 CAGGGTCTCCCCTGACCTCGTGG - Intergenic
1032095855 7:128938260-128938282 CAGGGTGCGCCCGGCCGGCCTGG + Intronic
1032130706 7:129225205-129225227 CAGGGTCTCCACCGCCCGCCGGG - Exonic
1032525852 7:132577619-132577641 CTGGGTCCCCTCGGCCCGCACGG + Intronic
1033159345 7:138982043-138982065 CAGGGTCCCGCGGGCCTCCCAGG - Intergenic
1033365939 7:140672888-140672910 CACGCTCCGCCCCGCCCTCCCGG + Intronic
1035287570 7:157816160-157816182 CAGAGACCCCCCAGCCCTGCCGG + Intronic
1036195253 8:6708433-6708455 AAGGGAACCCGCGGCCCTCCCGG - Exonic
1036210188 8:6834980-6835002 CAGGGTCCCCCTGGACGGCCGGG + Intronic
1036245970 8:7117007-7117029 CATGGTCACCCTGGCCCTGCTGG + Intergenic
1036616192 8:10389644-10389666 CAGGGTTCCCTCCGCCCTCTAGG - Intronic
1036888300 8:12577020-12577042 CATGGTCACCCTGGCCCTGCTGG - Intergenic
1038455006 8:27667282-27667304 CAGGGCACCACCTGCCCTCCAGG - Intronic
1038455690 8:27670896-27670918 TCAGGTGCCCCCGGCCCTCCAGG + Exonic
1038455830 8:27671292-27671314 CAGGGTCCCCCTGGTCTCCCGGG + Exonic
1038734516 8:30156678-30156700 CACAGCCCCCCCCGCCCTCCCGG - Intronic
1039449503 8:37660509-37660531 CCAGGTCCCCCTGGCTCTCCAGG + Intergenic
1040106774 8:43546126-43546148 CAGGGACTCCACGGCCCCCCTGG + Intergenic
1040109583 8:43561346-43561368 CAGGTACTCCACGGCCCTCCAGG + Intergenic
1040109854 8:43562464-43562486 CAGGGACTCCACGGCCCTCCCGG + Intergenic
1040278774 8:46027061-46027083 CAGGGACTCCACGACCCTCCCGG + Intergenic
1041662363 8:60412773-60412795 CAGGGTCCTCCCTTCCCTCCCGG + Intergenic
1041698857 8:60765697-60765719 GGGGCTGCCCCCGGCCCTCCTGG - Intronic
1043012730 8:74900833-74900855 CAGGGTCCCTTTGGCCCTCAGGG - Intergenic
1043478436 8:80627959-80627981 CAGGCTCCCAGAGGCCCTCCAGG - Intergenic
1044822019 8:96161115-96161137 CAGGGTCCCCCTCGAACTCCCGG + Intergenic
1046978838 8:120313974-120313996 CAGGGTCCACCTGGACCTCAAGG + Exonic
1048865130 8:138755164-138755186 CAAGGCGCCCCCGGTCCTCCAGG - Exonic
1049099688 8:140569909-140569931 CAGAGTCCCCACGAGCCTCCAGG + Intronic
1049466289 8:142752598-142752620 CAGGGGCTCCCCAGCCTTCCAGG + Intergenic
1049571470 8:143372092-143372114 CAGGCTCCCCGCAGCTCTCCTGG + Intronic
1049585970 8:143432518-143432540 CAGTGTGCCCCAGGGCCTCCAGG - Intergenic
1049671134 8:143870361-143870383 CAGGGTGGCCCTGGCCCTGCTGG - Exonic
1049720870 8:144114928-144114950 CAGGGTTCCCAAGGCCCCCCCGG - Intronic
1054351075 9:64017114-64017136 CGCGGTGCCCCCGGCCCGCCTGG - Intergenic
1056413357 9:86354082-86354104 CAGGGTTCCCCCGGCCGGCCAGG + Intronic
1057916517 9:99059900-99059922 CCAGGTCCCCCTGGCCCTCCAGG + Exonic
1059352771 9:113677256-113677278 AAGGGGCACCCGGGCCCTCCAGG - Intergenic
1059418763 9:114178288-114178310 CAGGGTCCCCCTGGGCTACCTGG + Exonic
1059419631 9:114183046-114183068 CCAGGTCTCCCCGGCCCTCCTGG + Exonic
1059433938 9:114265428-114265450 CCGGGTCCCTCAGGCCCCCCAGG + Exonic
1059435831 9:114275730-114275752 GACGGGCCCCCCGGCCCCCCTGG + Exonic
1059440062 9:114301679-114301701 CAGGGTCCTCCCGGCCCCAGAGG + Exonic
1061292001 9:129655650-129655672 CAGGGTCTCCACTGCCCACCTGG - Intergenic
1061425632 9:130496685-130496707 CAGGGCCCTCCTGCCCCTCCAGG - Intronic
1061858497 9:133455960-133455982 CAGGGTCCACCCCTACCTCCTGG + Intronic
1062103145 9:134738743-134738765 TAGGGTCTTCCCGGACCTCCAGG + Exonic
1062107892 9:134765705-134765727 AAGGGGCCCCCAGGTCCTCCCGG + Exonic
1062115200 9:134804972-134804994 CAGGGTGACCCAGGCCCTGCAGG + Exonic
1062116358 9:134811336-134811358 CAGGGTCCTCCTGGGCCTACAGG + Exonic
1062116577 9:134812611-134812633 CCGGGTCCCCCTGGCCCCCGAGG + Exonic
1062117434 9:134817023-134817045 CAGGGATCCCCCGGCCCTACTGG + Exonic
1062117591 9:134817775-134817797 CAGGGTCCCCCAGGCCCCGCAGG + Exonic
1062117921 9:134818997-134819019 CAGGGTCCCCCAGGACTTCCCGG + Exonic
1062118373 9:134821201-134821223 CAGGGTCCCCACGGCCAGCGGGG + Intronic
1062261166 9:135663924-135663946 CAGGGCCCCCGCTGCCCCCCAGG - Intronic
1062460144 9:136659553-136659575 CCGGGCCCTCCCGGGCCTCCCGG - Exonic
1062460151 9:136659562-136659584 CAGAGCCCCCCGGGCCCTCCCGG - Exonic
1203546662 Un_KI270743v1:133279-133301 CAGAATCCCCCCCACCCTCCCGG + Intergenic
1203551603 Un_KI270743v1:167767-167789 CGCGGTGCCCCCGGCCCGCCTGG - Intergenic
1185532210 X:830970-830992 AGGGGCTCCCCCGGCCCTCCAGG + Intergenic
1185782455 X:2861439-2861461 CAGGGCCCCACCCGCCCCCCAGG + Intronic
1186516562 X:10170668-10170690 CTGGGTTTCCCCAGCCCTCCTGG + Intronic
1189354442 X:40300279-40300301 CAGGGTCCGCCTGGGCCTCAGGG + Intergenic
1190878360 X:54475397-54475419 TTGGGTCCACCCGCCCCTCCTGG - Intronic
1191252121 X:58264725-58264747 CAGGGTCCCCCCGAACCTCGCGG - Intergenic
1191256660 X:58282466-58282488 CAGGGACTCCCCGACCCCCCAGG + Intergenic
1192195389 X:69024399-69024421 CCGGGTGCCCCCTGCCCTGCTGG - Intergenic
1192329138 X:70160092-70160114 CAGGGTCCCAGCTGCCCCCCTGG + Intronic
1193732391 X:85116721-85116743 TAGAGACCCCCCAGCCCTCCAGG - Intergenic
1195221249 X:102746543-102746565 CCGGCTCCCCCCGGCCTTCCCGG - Intronic
1195756687 X:108205676-108205698 TAGGGTCCTCCAGGGCCTCCTGG - Exonic
1195791051 X:108586717-108586739 CAGGGTCCACCTGGCCTTCCTGG + Exonic
1195791323 X:108591069-108591091 ATGGGTCCTCCTGGCCCTCCTGG + Exonic
1195797608 X:108668414-108668436 CAGGGTCCCCCAGGCCCTCCTGG + Exonic
1195799141 X:108687523-108687545 CAAGGTCCCCCAGGTCCCCCTGG + Exonic
1198242769 X:134801503-134801525 CAGGGACCCTTTGGCCCTCCAGG + Intronic
1201903507 Y:19066646-19066668 AAAGGTCACCCAGGCCCTCCTGG + Intergenic
1202047970 Y:20753218-20753240 CCTGGTTCCCCCGGACCTCCCGG - Intergenic