ID: 1148793591

View in Genome Browser
Species Human (GRCh38)
Location 17:50186903-50186925
Sequence CAGGGTCCCCCCGGCCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 2, 2: 12, 3: 56, 4: 520}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148793591_1148793602 25 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793602 17:50186951-50186973 TACCGGCATCCAAGTGCTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1148793591_1148793600 8 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793600 17:50186934-50186956 GGGAAGAGAGTGGGGATTACCGG 0: 1
1: 0
2: 2
3: 39
4: 310
1148793591_1148793603 26 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793603 17:50186952-50186974 ACCGGCATCCAAGTGCTTTGGGG 0: 1
1: 0
2: 1
3: 5
4: 69
1148793591_1148793597 -2 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793597 17:50186924-50186946 TGCACAGAGAGGGAAGAGAGTGG 0: 1
1: 0
2: 6
3: 80
4: 884
1148793591_1148793598 -1 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793598 17:50186925-50186947 GCACAGAGAGGGAAGAGAGTGGG 0: 1
1: 0
2: 4
3: 94
4: 775
1148793591_1148793605 27 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793605 17:50186953-50186975 CCGGCATCCAAGTGCTTTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 172
1148793591_1148793601 24 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793601 17:50186950-50186972 TTACCGGCATCCAAGTGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 49
1148793591_1148793599 0 Left 1148793591 17:50186903-50186925 CCAGGAGGGCCGGGGGGACCCTG 0: 1
1: 2
2: 12
3: 56
4: 520
Right 1148793599 17:50186926-50186948 CACAGAGAGGGAAGAGAGTGGGG 0: 1
1: 1
2: 12
3: 131
4: 1155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148793591 Original CRISPR CAGGGTCCCCCCGGCCCTCC TGG (reversed) Exonic