ID: 1148794519

View in Genome Browser
Species Human (GRCh38)
Location 17:50190636-50190658
Sequence GTCATCTACTAGGAGTATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148794519_1148794525 3 Left 1148794519 17:50190636-50190658 CCTGAATACTCCTAGTAGATGAC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1148794525 17:50190662-50190684 AGGAGAGCCTCCCCTCCTTCTGG 0: 1
1: 0
2: 2
3: 21
4: 197
1148794519_1148794532 21 Left 1148794519 17:50190636-50190658 CCTGAATACTCCTAGTAGATGAC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1148794532 17:50190680-50190702 TCTGGTCCCTCCAGGTTCCCAGG 0: 1
1: 1
2: 3
3: 35
4: 273
1148794519_1148794528 13 Left 1148794519 17:50190636-50190658 CCTGAATACTCCTAGTAGATGAC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1148794528 17:50190672-50190694 CCCCTCCTTCTGGTCCCTCCAGG 0: 1
1: 0
2: 1
3: 52
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148794519 Original CRISPR GTCATCTACTAGGAGTATTC AGG (reversed) Intronic
922893551 1:229081279-229081301 GTCATCTTATAGGAGTTTTATGG + Intergenic
1065408763 10:25398086-25398108 GTCCTCTTCTGAGAGTATTCAGG - Intronic
1068172006 10:53405847-53405869 ATCATCTACTTGGATGATTCTGG + Intergenic
1079563530 11:21852153-21852175 GTTTTCTACTAGGAGTTTTATGG - Intergenic
1086111171 11:83200054-83200076 TTCATCTAGTTGGAGTTTTCTGG + Intronic
1086551445 11:88057322-88057344 TTCATGTATTAGGACTATTCAGG - Intergenic
1088537612 11:110878255-110878277 GTCATCCCCAAGGAGAATTCTGG - Intergenic
1094446899 12:30540886-30540908 GTTATCTTCTAGGAGTTTTATGG + Intergenic
1095516680 12:43013878-43013900 GTCATTAAATAGGAGTATTCTGG + Intergenic
1106232346 13:27830335-27830357 GCCAGCTACTATGACTATTCAGG + Intergenic
1110931938 13:81230915-81230937 CTCCTCTAATAGGAGCATTCAGG - Intergenic
1112198013 13:97244431-97244453 GTCATCTGCTAAGAGAAATCGGG + Intronic
1116288973 14:43007488-43007510 TACATCTAATGGGAGTATTCTGG - Intergenic
1116986474 14:51225145-51225167 GTCATCTCCTAGGACAATACTGG + Intergenic
1118946229 14:70390232-70390254 GTCAGCTACTGGTAGAATTCAGG + Intronic
1125036394 15:35129462-35129484 GTCATCTATGAGGAACATTCTGG + Intergenic
1125247415 15:37657119-37657141 GTCTTCTTCTAGGAGTTTTATGG - Intergenic
1128541308 15:68535749-68535771 GTCATCTACAAGCAGTATGTAGG + Intergenic
1137722844 16:50637938-50637960 GTCATCTCCTGGGAGTACCCGGG + Exonic
1148794519 17:50190636-50190658 GTCATCTACTAGGAGTATTCAGG - Intronic
1149261643 17:54886594-54886616 GTCAATTACTAAGAGTCTTCAGG + Intergenic
1153067760 18:1065924-1065946 GTCTTCTACTATGAATAATCAGG + Intergenic
1153728563 18:7982785-7982807 GTCATCCCATAGGAGTATGCTGG - Intronic
1156675318 18:39520874-39520896 GTCTTCTACCATGAGTTTTCAGG + Intergenic
1159295114 18:66475434-66475456 GTAATCAACTAGGTGTATTGAGG + Intergenic
1159335296 18:67056426-67056448 GTCATCTTCTAGAGTTATTCTGG - Intergenic
1165525439 19:36350632-36350654 GTCATCTGCTTGAAGTATTTAGG - Intronic
927749661 2:25656145-25656167 GTCAGCTACTGGGAGAATTAAGG + Intronic
929826768 2:45315013-45315035 GTCATCTGCCAGGAGTAATATGG + Intergenic
934956520 2:98625921-98625943 GACATCTACTAGAAATATTTTGG - Intronic
938253083 2:129831329-129831351 GTCATATACTGGGAGTGTTGGGG + Intergenic
940482567 2:154253662-154253684 ATCATCTAATAGGAGTTTTAGGG - Intronic
947703278 2:232253624-232253646 GTCATGTATTAGGAGGATTAAGG + Intronic
1169666967 20:8048309-8048331 GATATCTACCAGGAGCATTCAGG + Intergenic
1174691531 20:52511267-52511289 GTCATGTGCAAGGAATATTCTGG - Intergenic
1177295557 21:19169663-19169685 GTCATCAAATGGCAGTATTCAGG - Intergenic
1179891582 21:44338482-44338504 GTCACCTGCTAGGAGTACCCTGG + Intronic
952128159 3:30327613-30327635 TTTATCTTCTAGGAGTTTTCTGG - Intergenic
954852792 3:53617690-53617712 GTCAACTAACAGGATTATTCAGG + Intronic
959046821 3:101484079-101484101 GTTATCTTCTAGGAGTTTTATGG - Intronic
965572872 3:170189117-170189139 CTCATCTACTAGGATTACTAGGG + Intergenic
966725231 3:183102666-183102688 TTCATCTACTTGGAATATTTTGG - Intronic
966765220 3:183455437-183455459 CTCATCTGTTACGAGTATTCAGG - Intergenic
967707776 3:192672382-192672404 TTCATCTACTTGGAATTTTCAGG - Intronic
971645529 4:29196321-29196343 GTCTTCTGCTAGGACTATTTTGG + Intergenic
972239103 4:37170296-37170318 GTCTTCTTCTAAGACTATTCTGG + Intergenic
972635885 4:40883660-40883682 GTCTTCTACTAGCAGCATTCGGG - Intronic
975693321 4:76986997-76987019 TTCCTCTACTGGGAGTCTTCTGG + Intronic
984827239 4:183937286-183937308 GACATTAACTAGGAGAATTCTGG - Intronic
985433798 4:189907798-189907820 GTCTTCTTCTAGGAGTTTTATGG + Intergenic
986572275 5:9177668-9177690 TGCATCTCCTAGGAGTATCCTGG - Intronic
986950412 5:13076467-13076489 GTCATGTACTAGGTAGATTCTGG - Intergenic
988804985 5:34732018-34732040 GTCATCTCCGAGGAGTCTTTAGG - Intronic
989727874 5:44608863-44608885 GTCATCTACTAGAATTTTTATGG - Intergenic
990351636 5:54922993-54923015 GTCATCTTCTAGGATTTTTATGG - Intergenic
994761508 5:103860177-103860199 GTCCTCTACTAGAGGTAATCTGG - Intergenic
994767185 5:103933633-103933655 GACATCTTCTAGGAATACTCAGG + Intergenic
996477779 5:123940861-123940883 GTAATTTATTAGAAGTATTCAGG + Intergenic
997026351 5:130066734-130066756 GTCATCTACTCTGAGTATTTAGG + Intronic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998012364 5:138705503-138705525 GTCTTTTACAAGGAGTCTTCTGG - Intronic
1000457719 5:161472473-161472495 GTCATATACTAGAACTATTTGGG + Intronic
1008013825 6:46495411-46495433 GTTATCTTCTAGGAGTTTTATGG + Intergenic
1016345998 6:143114733-143114755 GTCAGTTATTTGGAGTATTCTGG + Intronic
1022598844 7:31737954-31737976 GGCATCTACTAGGGTTTTTCAGG - Intergenic
1023961004 7:44926063-44926085 GTCATTCTCTAGAAGTATTCTGG - Intergenic
1025712115 7:63921803-63921825 GTTATCTTCTAGGAGTTTTGTGG - Intergenic
1029920501 7:104257445-104257467 CTCAACTACTAAGAGTACTCAGG - Intergenic
1029968789 7:104768713-104768735 GTCATCTAAAAGGAGGATGCTGG - Intronic
1030230497 7:107203876-107203898 GTCATATACTCGGAGTCCTCTGG + Intronic
1035260365 7:157658100-157658122 GTCATCAACGTGGAATATTCTGG + Intronic
1039386197 8:37137877-37137899 GTGATGTACTAGTTGTATTCTGG + Intergenic
1043327211 8:79067447-79067469 GTTATCTTCTAGGAGTCTTATGG - Intergenic
1044260883 8:90119154-90119176 GCAATGTACTAGGAGTAATCAGG + Intergenic
1046938662 8:119910128-119910150 GGCATATACCAAGAGTATTCAGG + Intronic
1049314808 8:141959038-141959060 TTCATCTACTAGTGGTCTTCTGG - Intergenic
1049930961 9:456201-456223 CTCATCTACTATCTGTATTCAGG - Intronic
1050574893 9:6984346-6984368 GTCATCTGCTAGCAGGATGCAGG + Exonic
1052247514 9:26354345-26354367 GTCTTCTTCTAGGAGTTTTGTGG - Intergenic
1053384996 9:37680050-37680072 GTCTTCTACTAGGAGTGGCCTGG + Intronic
1057323803 9:94040831-94040853 GTCAGCACCTAGGAGTCTTCAGG - Intronic
1186826444 X:13344891-13344913 GTTTTCTTCTAGGAGTATTACGG - Intergenic
1190967524 X:55314977-55314999 GTTATCTACTAGAATTATTATGG + Intergenic
1192487868 X:71546073-71546095 TCCATCTACTAGGAATATGCTGG - Intronic
1192914829 X:75640690-75640712 GTCCTCTACAAGGAATCTTCAGG - Intergenic