ID: 1148795480

View in Genome Browser
Species Human (GRCh38)
Location 17:50194810-50194832
Sequence CTTGAACACCAACAGGGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148795469_1148795480 5 Left 1148795469 17:50194782-50194804 CCTTCCTCTCCAGCAGGGCCAGG 0: 1
1: 0
2: 5
3: 76
4: 558
Right 1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 164
1148795475_1148795480 -4 Left 1148795475 17:50194791-50194813 CCAGCAGGGCCAGGGGGTCCTTG 0: 1
1: 0
2: 6
3: 48
4: 408
Right 1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 164
1148795474_1148795480 1 Left 1148795474 17:50194786-50194808 CCTCTCCAGCAGGGCCAGGGGGT 0: 1
1: 0
2: 2
3: 42
4: 347
Right 1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 164
1148795466_1148795480 14 Left 1148795466 17:50194773-50194795 CCTCGCTTTCCTTCCTCTCCAGC 0: 1
1: 0
2: 1
3: 48
4: 682
Right 1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 164
1148795465_1148795480 23 Left 1148795465 17:50194764-50194786 CCTCGAGCTCCTCGCTTTCCTTC 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148795480 Original CRISPR CTTGAACACCAACAGGGCCC TGG Exonic
901804643 1:11730573-11730595 CCTGGACTCCAACAGGGCACAGG + Intergenic
904335387 1:29793983-29794005 CTTGAACACCGGCAGGTACCTGG - Intergenic
906580813 1:46934095-46934117 CCTGAACACCAGCAAGGCCTGGG + Intronic
906602911 1:47144799-47144821 CCTGAACACCAGCAAGGCCTGGG - Intronic
907176380 1:52527250-52527272 TTTAAAAACCAACAGGGGCCGGG + Intronic
914804301 1:150981549-150981571 CTAAAACAGCCACAGGGCCCAGG + Intergenic
916588129 1:166165990-166166012 CTTCAACACCTACAGCGACCTGG - Exonic
917834688 1:178932022-178932044 CTTGAGAACCAGCGGGGCCCTGG - Intergenic
920416132 1:205800397-205800419 CCTGAACAGATACAGGGCCCTGG - Intronic
921577624 1:216855232-216855254 CTTGAACAATAACAGGGCTTAGG + Intronic
921613983 1:217245003-217245025 CTTGAACTCCAAGAAGGCCTCGG + Intergenic
921958253 1:221006442-221006464 CTTGAATCCCAACAGGCCACTGG - Intergenic
924613087 1:245589943-245589965 CTTGGAGAACAACAGGACCCAGG - Intronic
924786881 1:247207185-247207207 CTCCAACACCAACAGGGTGCTGG + Intergenic
1063586637 10:7358494-7358516 CTAGAACACCTGCATGGCCCTGG + Intronic
1063586663 10:7358627-7358649 CTAGAACATCAGCATGGCCCTGG + Intronic
1064380267 10:14835785-14835807 CTTGAATATCTACAGGGGCCAGG + Intronic
1064719620 10:18215805-18215827 CTTAAACATCAACATGGCCTTGG - Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067682647 10:48450481-48450503 CCTGCACACCGACTGGGCCCTGG - Exonic
1069659131 10:70112054-70112076 CACGCACACCAACAGAGCCCAGG - Exonic
1076406506 10:130215602-130215624 CTTGGAGGCCAAGAGGGCCCAGG + Intergenic
1077036208 11:495703-495725 CTGGAACACCCACAAGGTCCTGG + Intronic
1077888734 11:6404027-6404049 ATTAGCCACCAACAGGGCCCAGG - Intronic
1077902266 11:6498803-6498825 CCTGAGCACCAACAATGCCCAGG - Exonic
1084716397 11:70877000-70877022 CTGGAACACACACATGGCCCTGG + Intronic
1084858712 11:72004650-72004672 CTAGAGCCCCACCAGGGCCCTGG - Exonic
1085689293 11:78652409-78652431 CTGGAAAACCCACAGGGGCCTGG + Intergenic
1091434672 12:462974-462996 CTTGGATACCAACAGGAACCAGG + Intronic
1091449052 12:561506-561528 CCTGAACAGTAGCAGGGCCCTGG - Exonic
1091692938 12:2609430-2609452 CTTGAAAACCCACAGGGGACTGG - Intronic
1093095165 12:14963673-14963695 CATGAGCAGCAACACGGCCCTGG + Intergenic
1093561888 12:20552132-20552154 CACCAACACCAACAGGGCGCTGG + Intronic
1095906743 12:47385936-47385958 ATTCACCAGCAACAGGGCCCAGG + Intergenic
1095917781 12:47497596-47497618 TGTGTACACCACCAGGGCCCTGG + Intergenic
1096569940 12:52516686-52516708 CATGAACACCAAGCTGGCCCTGG - Exonic
1099342277 12:81452176-81452198 CTTGAAAAGCAAGATGGCCCAGG + Intronic
1100099080 12:91080554-91080576 CTCACAGACCAACAGGGCCCTGG - Intergenic
1103162150 12:118738393-118738415 TTTGAACACCATGATGGCCCAGG + Intergenic
1104763322 12:131311337-131311359 CTTGACCAGCCACAGGGGCCTGG - Intergenic
1104816176 12:131646733-131646755 CTTGACCAGCCACAGGGGCCTGG + Intergenic
1105587691 13:21760079-21760101 TTTGAACACCATCCGGGCCTTGG + Intergenic
1111627906 13:90813220-90813242 CCTTTACACCACCAGGGCCCTGG + Intergenic
1113310203 13:109124097-109124119 CTTGTACACACTCAGGGCCCAGG + Intronic
1113944138 13:114034131-114034153 CCTGAACACCAGCCGGGCACTGG + Intronic
1116743810 14:48792490-48792512 TTTCCACACCACCAGGGCCCTGG + Intergenic
1117013879 14:51498563-51498585 CTGGAAGATCAACAGGGGCCTGG + Intronic
1118319201 14:64743343-64743365 CCTGAGCACCAAGAGGGGCCGGG + Exonic
1121081875 14:91114914-91114936 CATCAACACCAACATGGCACAGG + Intronic
1121447266 14:93987132-93987154 CTGGAACACCAGGAGGGCCACGG - Intergenic
1121565895 14:94908821-94908843 CCTCTACACCTACAGGGCCCTGG - Intergenic
1202897151 14_GL000194v1_random:16782-16804 CTTGATGACCAACTGGGTCCTGG - Intergenic
1126918054 15:53487833-53487855 CTTGATCACCAACAGTACCAAGG + Intergenic
1127697355 15:61463362-61463384 TTTGAACAACATCAGGGCCTTGG - Intergenic
1130087285 15:80788069-80788091 TTTGCACACCGACAGGGGCCTGG - Intronic
1131152305 15:90054624-90054646 CTTGAACTTCATCAGGGCCTGGG - Intronic
1131258004 15:90874067-90874089 CCTGAGCAGCAGCAGGGCCCTGG - Intronic
1132637368 16:958584-958606 CTTGAAAACGGACAGTGCCCAGG + Intronic
1133700872 16:8307639-8307661 CCTGAGCACCTGCAGGGCCCAGG + Intergenic
1140644871 16:77018542-77018564 CTTGAACTCCAACTGGGACTGGG + Intergenic
1141267991 16:82514138-82514160 CATGCATACCAACAGGGTCCCGG + Intergenic
1141944386 16:87299277-87299299 CATGAACACAAGGAGGGCCCAGG - Intronic
1143012929 17:3876187-3876209 CTTGAACCCCAGCCTGGCCCAGG + Intronic
1144573420 17:16415061-16415083 CCTCACCACCAACGGGGCCCTGG - Intergenic
1145274324 17:21420863-21420885 GTTGAGCACCAACTGGGGCCAGG - Intergenic
1145312184 17:21706767-21706789 GTTGAGCACCAACTGGGGCCAGG - Intergenic
1147656829 17:42095852-42095874 CTGGAACACTCACAGGGCCTGGG + Intergenic
1148156546 17:45427990-45428012 CTTGCAGACCTACAGAGCCCTGG + Intronic
1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG + Exonic
1152564110 17:81092524-81092546 CTTGAACAACAGGAGGCCCCCGG - Intronic
1155358764 18:24979776-24979798 CTTGAATGCCCAGAGGGCCCAGG + Intergenic
1158667351 18:59444458-59444480 CATTCACACCAACAGTGCCCAGG + Intronic
1160490266 18:79331924-79331946 CTTGAACAACACGAGGGCCAGGG + Intronic
1160574828 18:79847307-79847329 GTTCAACACCCACAGTGCCCAGG - Intergenic
1160693424 19:470820-470842 GATGAACACCAACAGCTCCCTGG + Intronic
1162361803 19:10224860-10224882 CCTGAACCCCAACAAGGTCCAGG - Exonic
1163716993 19:18878606-18878628 CCTCACCACCCACAGGGCCCTGG + Exonic
1163847372 19:19645355-19645377 CGGGAACCCCAACAGGGCCCCGG - Exonic
1168137496 19:54361111-54361133 TTTGAACCCCAACCGGGCCCCGG + Exonic
1168160577 19:54507967-54507989 TTTGAACCCCAACCGGGCCCCGG - Exonic
928446478 2:31337817-31337839 CCTGAACACAGACAGGGCACAGG + Exonic
928451863 2:31385019-31385041 CTTGGAATCCAACTGGGCCCAGG + Intronic
933850880 2:86365550-86365572 CTGCATCACCCACAGGGCCCAGG + Intergenic
938491160 2:131762016-131762038 CTTGATGACCAACTGGGTCCTGG + Intronic
938496404 2:131800321-131800343 CTTGATGACCAACTGGGTCCTGG - Intronic
938568153 2:132539171-132539193 CATCTACACCACCAGGGCCCTGG - Intronic
938923838 2:136020584-136020606 CTTGAACTCCTACTGGGCACTGG + Intergenic
941008245 2:160269645-160269667 CTTGAACACCTCCAGGGACCAGG - Intronic
942463054 2:176182676-176182698 GTTGATCAGCATCAGGGCCCTGG - Intergenic
943658860 2:190536291-190536313 CTTTACCACCAACAGGATCCTGG + Intergenic
944428206 2:199605637-199605659 CTAGGCCTCCAACAGGGCCCTGG + Intergenic
946189896 2:218002633-218002655 TTTCCCCACCAACAGGGCCCAGG - Intronic
946980464 2:225208443-225208465 CTTGAGCACCACCGGAGCCCAGG + Intergenic
947228905 2:227866062-227866084 CTTGAAAACTAACAGGGCCAGGG - Intergenic
947539993 2:230969792-230969814 CTTGAAGTCCATCAGGGACCAGG + Intergenic
947986454 2:234451764-234451786 CCTGAAGAACAACAGAGCCCAGG - Intergenic
1169066682 20:2697900-2697922 CCTGCACACTAGCAGGGCCCCGG + Intronic
1170438368 20:16352823-16352845 CCTCAACACCAAGTGGGCCCTGG + Intronic
1175787066 20:61718364-61718386 CTTCAACACCCAGAGGGACCAGG - Exonic
1176235974 20:64053734-64053756 CTTCCACATCACCAGGGCCCTGG - Intronic
1176616836 21:9032771-9032793 CTTGATGACCAACTGGGTCCTGG - Intergenic
1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG + Intronic
1181237392 22:21455883-21455905 CTGGGCCACCAGCAGGGCCCAGG + Intergenic
1181403969 22:22668737-22668759 CTTGACCATCAGCGGGGCCCAGG + Intergenic
1181407466 22:22694997-22695019 CCTGGCCATCAACAGGGCCCAGG + Intergenic
1181415468 22:22755764-22755786 CCTGACCATCAACAGGACCCAGG + Intronic
1181566679 22:23742972-23742994 CTTGGACATCAGCAGGGCCTGGG - Exonic
1182085736 22:27560072-27560094 CTGCAACCCCCACAGGGCCCAGG - Intergenic
1182740501 22:32563962-32563984 CTTGAAACCCAACAGGGGCCGGG - Intronic
1183664765 22:39241004-39241026 CTTGCACACCTCCAGGGCTCTGG + Intronic
1184027109 22:41865979-41866001 CAAGAATACCAACAGTGCCCAGG + Intronic
1185051374 22:48555950-48555972 CTAGAACAAGAAGAGGGCCCTGG - Intronic
950436312 3:12982596-12982618 CTTAAACACCCACGGGGGCCAGG - Intronic
951117210 3:18878798-18878820 CTTAAATACCTACAGGACCCAGG + Intergenic
954683301 3:52357600-52357622 ATTGATCACCTGCAGGGCCCGGG - Exonic
954893883 3:53958791-53958813 CTTGCCAACCACCAGGGCCCTGG + Intergenic
955005067 3:54960888-54960910 CTTGGACACCAACAGACCTCCGG + Intronic
956293268 3:67684251-67684273 GATGAACAACAACAGGGCCCGGG - Intergenic
956497583 3:69844988-69845010 GTTAAACATCTACAGGGCCCAGG - Intronic
956908402 3:73790942-73790964 CTTGGTCACCAACAGGGGCTGGG + Intergenic
957009403 3:74986462-74986484 TGTGTACACCACCAGGGCCCTGG - Intergenic
959839814 3:110961418-110961440 CTTGAACACAACCAGGGGCAGGG + Intergenic
961470282 3:127107143-127107165 CTTGAACACAGTCAGGGCCGTGG + Intergenic
964634012 3:158841542-158841564 CTGGAGGACCACCAGGGCCCAGG + Intergenic
966136259 3:176701751-176701773 ATTGAACTCCTACTGGGCCCTGG - Intergenic
967175183 3:186856160-186856182 CTTGAGTACCAACAGGGTCAGGG + Exonic
968921477 4:3524305-3524327 CTTGAATACCCACAGGGACGAGG + Intronic
969705994 4:8791898-8791920 CCGGAACACCAAGCGGGCCCAGG - Intergenic
975712226 4:77172331-77172353 CTTGAGTACCAAGAGGTCCCGGG - Intronic
980114209 4:128663715-128663737 CCTGAACACCCAAAGTGCCCAGG - Intergenic
981234846 4:142403208-142403230 CTTGGGCAACAACATGGCCCAGG + Intronic
984927578 4:184820031-184820053 TTTGAACAGGCACAGGGCCCGGG + Intronic
985791461 5:1930748-1930770 CTTGGTCACCACCTGGGCCCTGG - Intergenic
988078345 5:26382349-26382371 CCTGTAGAACAACAGGGCCCAGG + Intergenic
989825292 5:45847828-45847850 TATGTACACCACCAGGGCCCTGG + Intergenic
992194814 5:74328662-74328684 CTTCAACACCTCCAGAGCCCAGG + Intergenic
993513871 5:88805314-88805336 CTAGAAACCCAACAGGGCACTGG + Intronic
995095220 5:108228144-108228166 CTCTAACATCAACAGAGCCCTGG + Intronic
997225934 5:132209485-132209507 CTGGAAAACCAACAGAGGCCAGG + Intronic
998256815 5:140594498-140594520 CCTGAGCAGCATCAGGGCCCAGG + Intergenic
999713830 5:154343105-154343127 CCTGGACACTCACAGGGCCCGGG - Intronic
1001194921 5:169663740-169663762 GCTGCACAGCAACAGGGCCCTGG + Intronic
1001956191 5:175849740-175849762 CGTGAGCTCCAACAGGGCCCTGG + Intronic
1002956542 6:1870867-1870889 AGTAAACACAAACAGGGCCCAGG + Intronic
1003831169 6:10013371-10013393 CTTGATAACCAACAGGACGCAGG + Intronic
1005463998 6:26094062-26094084 CTTGAAATCCAATAGTGCCCAGG + Intronic
1006154652 6:32007695-32007717 CTAGACCACGAACTGGGCCCTGG + Intergenic
1006160964 6:32040430-32040452 CTAGACCACGAACTGGGCCCTGG + Exonic
1015951683 6:138559411-138559433 CTTATACACCAACGGGGTCCTGG + Intronic
1021510903 7:21430785-21430807 CTTGAACACCTGCAGCACCCAGG - Exonic
1033305705 7:140223845-140223867 CTAGAGCACCAACGGAGCCCCGG - Intergenic
1033832131 7:145267470-145267492 CTTGGACAGCCACAGGGCCCAGG + Intergenic
1034607498 7:152330611-152330633 CTTCTACACCAACAGAGACCAGG + Exonic
1040357696 8:46635699-46635721 CTTGCACATGAACAGGGCCTTGG + Intergenic
1042494850 8:69444557-69444579 GTTGAAAACCAACTGGGCCAAGG + Intergenic
1044080462 8:87875975-87875997 CTTGAACAGGAACAGGCCACTGG - Intergenic
1055641908 9:78325420-78325442 CTGGAAGACCTACAGGGCCGGGG - Intronic
1058572795 9:106365681-106365703 CTTGAACAGCCTCAGGGACCAGG - Intergenic
1058711678 9:107684362-107684384 CTGGAAAAACAACAAGGCCCAGG + Intergenic
1060002522 9:119971172-119971194 CATGGACACCAACACGGCCTTGG - Intergenic
1061721884 9:132556945-132556967 CATTAAACCCAACAGGGCCCGGG - Intronic
1061975630 9:134067056-134067078 CGTGTACACCCACATGGCCCTGG - Intronic
1062190589 9:135245970-135245992 CTTGAACCCCCACAGGGCTGGGG + Intergenic
1187004130 X:15215213-15215235 CATTAGCACCATCAGGGCCCTGG + Intergenic
1187544070 X:20230185-20230207 ATTGAACACCAACTGGGTACTGG + Intronic
1189064916 X:37797102-37797124 CTTGGCCACCAACTGGGCTCTGG - Intronic
1189340595 X:40201891-40201913 CTGGAACACCAAGAGGCCTCTGG - Intergenic
1189346379 X:40244777-40244799 GCTGAACACCAAGAGGCCCCAGG - Intergenic
1190221399 X:48514521-48514543 CTTGGACACCGTCAGGTCCCTGG - Exonic
1194880847 X:99250090-99250112 CTTGAAAACCAACAGTCCCATGG - Intergenic
1196093053 X:111767396-111767418 CTTTTACACCAGCAGGGCACTGG - Intergenic
1196482709 X:116168430-116168452 CTTGAACACCCACAAGGAACAGG - Intergenic
1197623506 X:128778842-128778864 AGTGAACACCAACAGTGGCCTGG - Intergenic
1199120232 X:144043848-144043870 CATCAACACTAACAGTGCCCTGG - Intergenic
1199581675 X:149366783-149366805 CTCAAACACCTACAGGGGCCAGG - Intergenic