ID: 1148796886

View in Genome Browser
Species Human (GRCh38)
Location 17:50201340-50201362
Sequence GCGCTTGGTCCCGGGGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148796886_1148796895 19 Left 1148796886 17:50201340-50201362 CCGCGGCCCCCGGGACCAAGCGC 0: 1
1: 0
2: 4
3: 13
4: 259
Right 1148796895 17:50201382-50201404 CCTTGCACTCCCAAAAGTTTGGG 0: 1
1: 0
2: 0
3: 113
4: 2426
1148796886_1148796893 18 Left 1148796886 17:50201340-50201362 CCGCGGCCCCCGGGACCAAGCGC 0: 1
1: 0
2: 4
3: 13
4: 259
Right 1148796893 17:50201381-50201403 TCCTTGCACTCCCAAAAGTTTGG 0: 1
1: 0
2: 0
3: 25
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148796886 Original CRISPR GCGCTTGGTCCCGGGGGCCG CGG (reversed) Intronic